Incidental Mutation 'R4056:Wif1'
ID314257
Institutional Source Beutler Lab
Gene Symbol Wif1
Ensembl Gene ENSMUSG00000020218
Gene NameWnt inhibitory factor 1
SynonymsWIF-1
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121033960-121100650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121082194 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 156 (V156I)
Ref Sequence ENSEMBL: ENSMUSP00000020439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020439] [ENSMUST00000175867]
Predicted Effect probably benign
Transcript: ENSMUST00000020439
AA Change: V156I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020439
Gene: ENSMUSG00000020218
AA Change: V156I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
WIF 35 179 8.47e-90 SMART
EGF 181 210 3.88e-3 SMART
EGF 213 242 4.46e-3 SMART
EGF 245 274 4.7e-2 SMART
EGF 277 306 1.69e-3 SMART
EGF 309 338 7.95e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145691
Predicted Effect probably benign
Transcript: ENSMUST00000175867
AA Change: V156I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135486
Gene: ENSMUSG00000020218
AA Change: V156I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
WIF 35 179 8.47e-90 SMART
EGF 181 210 3.88e-3 SMART
EGF 213 242 4.46e-3 SMART
EGF 245 274 4.7e-2 SMART
EGF 295 324 7.95e0 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions to inhibit WNT proteins, which are extracellular signaling molecules that play a role in embryonic development. This protein contains a WNT inhibitory factor (WIF) domain and five epidermal growth factor (EGF)-like domains, and is thought to be involved in mesoderm segmentation. This gene functions as a tumor suppressor gene, and has been found to be epigenetically silenced in various cancers. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous null mice are viable and fertile but display increased susceptibility to spontaneous and induced osteosarcomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Wif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Wif1 APN 10 121084950 missense possibly damaging 0.55
IGL01707:Wif1 APN 10 121083985 critical splice donor site probably null
IGL01932:Wif1 APN 10 121096035 missense probably damaging 1.00
IGL02183:Wif1 APN 10 121075276 missense probably damaging 1.00
R0653:Wif1 UTSW 10 121099799 missense probably benign 0.01
R1858:Wif1 UTSW 10 121083883 splice site probably null
R1869:Wif1 UTSW 10 121084919 missense probably benign 0.00
R1871:Wif1 UTSW 10 121084919 missense probably benign 0.00
R4057:Wif1 UTSW 10 121082194 missense probably benign 0.04
R5056:Wif1 UTSW 10 121099779 missense probably benign 0.00
R6242:Wif1 UTSW 10 121034461 missense possibly damaging 0.82
R6504:Wif1 UTSW 10 121035091 missense probably damaging 0.96
R7220:Wif1 UTSW 10 121090114 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCAGTGGTGAGACATGAAAATCAC -3'
(R):5'- TGTGGTGTCAAAACTGGAGAAAATC -3'

Sequencing Primer
(F):5'- CACAGAATTGTAAACCTTTTGCTTCC -3'
(R):5'- AGACTCTCATTTTAGCTGCCTGGAAG -3'
Posted On2015-04-30