Incidental Mutation 'R4056:Plekhg3'
ID314262
Institutional Source Beutler Lab
Gene Symbol Plekhg3
Ensembl Gene ENSMUSG00000052609
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 3
SynonymsMGC40768
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76530891-76580488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76565247 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 374 (I374N)
Ref Sequence ENSEMBL: ENSMUSP00000151851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075249] [ENSMUST00000218380] [ENSMUST00000219063] [ENSMUST00000219751]
Predicted Effect probably damaging
Transcript: ENSMUST00000075249
AA Change: I374N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074729
Gene: ENSMUSG00000052609
AA Change: I374N

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
RhoGEF 97 271 6.67e-51 SMART
PH 297 396 2.48e-9 SMART
coiled coil region 515 552 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 978 993 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218357
Predicted Effect probably benign
Transcript: ENSMUST00000218380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218461
Predicted Effect probably damaging
Transcript: ENSMUST00000219063
AA Change: I374N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219426
Predicted Effect probably benign
Transcript: ENSMUST00000219751
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Plekhg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Plekhg3 APN 12 76562278 missense probably damaging 0.99
IGL01143:Plekhg3 APN 12 76564982 critical splice donor site probably null
IGL02079:Plekhg3 APN 12 76560429 missense probably benign 0.01
IGL02349:Plekhg3 APN 12 76562300 missense probably damaging 1.00
IGL02442:Plekhg3 APN 12 76578353 missense probably benign 0.01
IGL02570:Plekhg3 APN 12 76578245 missense probably benign
R0344:Plekhg3 UTSW 12 76566266 nonsense probably null
R0667:Plekhg3 UTSW 12 76576598 missense probably damaging 1.00
R1269:Plekhg3 UTSW 12 76560469 missense probably damaging 1.00
R1566:Plekhg3 UTSW 12 76572065 missense possibly damaging 0.54
R1905:Plekhg3 UTSW 12 76576217 missense probably benign 0.05
R2885:Plekhg3 UTSW 12 76564961 missense probably benign 0.15
R2962:Plekhg3 UTSW 12 76572659 critical splice donor site probably null
R3784:Plekhg3 UTSW 12 76560520 critical splice donor site probably null
R3941:Plekhg3 UTSW 12 76573359 missense probably damaging 0.98
R4080:Plekhg3 UTSW 12 76577981 missense probably benign 0.02
R4412:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4413:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4704:Plekhg3 UTSW 12 76578238 missense probably damaging 1.00
R4720:Plekhg3 UTSW 12 76578322 missense possibly damaging 0.59
R4738:Plekhg3 UTSW 12 76576914 missense probably damaging 1.00
R4898:Plekhg3 UTSW 12 76564125 missense probably damaging 1.00
R4994:Plekhg3 UTSW 12 76565537 missense possibly damaging 0.68
R4999:Plekhg3 UTSW 12 76565247 missense possibly damaging 0.95
R5484:Plekhg3 UTSW 12 76578400 missense possibly damaging 0.76
R5591:Plekhg3 UTSW 12 76560292 missense possibly damaging 0.80
R6019:Plekhg3 UTSW 12 76577941 nonsense probably null
R6147:Plekhg3 UTSW 12 76565211 missense probably damaging 0.96
R6272:Plekhg3 UTSW 12 76576845 missense probably benign 0.00
R6482:Plekhg3 UTSW 12 76576004 missense probably benign 0.01
R7081:Plekhg3 UTSW 12 76578245 missense probably benign
X0062:Plekhg3 UTSW 12 76573343 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCTGGCTTCAATGGGCTCTG -3'
(R):5'- TTCAGGTCAGAACTGCCCAG -3'

Sequencing Primer
(F):5'- GCTGCCATCTTCTGAGACTTG -3'
(R):5'- CAGTACTTTCTACCAAGGGACAG -3'
Posted On2015-04-30