Incidental Mutation 'R4056:Net1'
ID314263
Institutional Source Beutler Lab
Gene Symbol Net1
Ensembl Gene ENSMUSG00000021215
Gene Nameneuroepithelial cell transforming gene 1
SynonymsmNET1, 0610025H04Rik, 9530071N24Rik, Net1 homolog
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3882018-3918220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3884949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 359 (T359I)
Ref Sequence ENSEMBL: ENSMUSP00000097529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091853] [ENSMUST00000099946] [ENSMUST00000222504]
Predicted Effect probably damaging
Transcript: ENSMUST00000091853
AA Change: T413I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089464
Gene: ENSMUSG00000021215
AA Change: T413I

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
RhoGEF 178 355 2.84e-54 SMART
PH 387 503 5.79e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099946
AA Change: T359I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097529
Gene: ENSMUSG00000021215
AA Change: T359I

DomainStartEndE-ValueType
RhoGEF 124 301 2.84e-54 SMART
PH 333 449 5.79e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222442
Predicted Effect probably benign
Transcript: ENSMUST00000222504
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of the family of Rho guanine nucleotide exchange factors. Members of this family activate Rho proteins by catalyzing the exchange of GDP for GTP. The protein encoded by this gene interacts with RhoA within the cell nucleus and may play a role in repairing DNA damage after ionizing radiation. Pseudogenes of this gene are located on the long arms of chromosomes 1, 7 and 18. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed mammary gland development during puberty associated with slower ductal extension, reduced ductal branching and epithelial cell proliferation, disorganized myoepithelial and ductal epithelial cells, and increased collagen deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Net1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Net1 APN 13 3893391 utr 5 prime probably benign
IGL02271:Net1 APN 13 3887663 missense probably damaging 1.00
IGL02698:Net1 APN 13 3887569 critical splice donor site probably null
R0580:Net1 UTSW 13 3886612 missense probably damaging 1.00
R1028:Net1 UTSW 13 3884375 missense probably damaging 1.00
R1070:Net1 UTSW 13 3912930 missense probably benign 0.31
R1775:Net1 UTSW 13 3887642 missense probably damaging 1.00
R1834:Net1 UTSW 13 3912941 unclassified probably benign
R3968:Net1 UTSW 13 3907795 critical splice donor site probably null
R4884:Net1 UTSW 13 3884252 nonsense probably null
R4937:Net1 UTSW 13 3884905 missense probably damaging 1.00
R5068:Net1 UTSW 13 3886740 missense probably benign 0.30
R5123:Net1 UTSW 13 3886623 missense probably damaging 0.97
R5389:Net1 UTSW 13 3886170 missense probably damaging 1.00
R5390:Net1 UTSW 13 3893379 missense probably benign 0.18
R5509:Net1 UTSW 13 3884320 missense probably benign 0.00
R6548:Net1 UTSW 13 3886074 intron probably null
R7056:Net1 UTSW 13 3884845 missense probably benign 0.00
R7138:Net1 UTSW 13 3888510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCAGCATATGACTGGG -3'
(R):5'- CCTGGAAAGCCATGAGATCAC -3'

Sequencing Primer
(F):5'- GCCCAGGTTAGCTTCAAATG -3'
(R):5'- CTCAAATCCAGTTCTTTAGCAA -3'
Posted On2015-04-30