Incidental Mutation 'R4056:Spata31'
ID314265
Institutional Source Beutler Lab
Gene Symbol Spata31
Ensembl Gene ENSMUSG00000056223
Gene Namespermatogenesis associated 31
Synonyms4930458L03Rik, Fam75a, Spata31a
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location64917406-64923194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64921655 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 539 (V539E)
Ref Sequence ENSEMBL: ENSMUSP00000097025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070216] [ENSMUST00000221202]
Predicted Effect probably benign
Transcript: ENSMUST00000070216
AA Change: V539E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097025
Gene: ENSMUSG00000056223
AA Change: V539E

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:FAM75 149 431 1.7e-83 PFAM
Pfam:FAM75 426 462 4.5e-9 PFAM
low complexity region 478 491 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221202
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Spata31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Spata31 APN 13 64922788 nonsense probably null
IGL01143:Spata31 APN 13 64920816 nonsense probably null
IGL01321:Spata31 APN 13 64921754 missense probably benign 0.01
IGL01624:Spata31 APN 13 64921585 missense probably damaging 1.00
IGL01844:Spata31 APN 13 64921154 missense possibly damaging 0.49
IGL02259:Spata31 APN 13 64921483 missense possibly damaging 0.90
IGL02358:Spata31 APN 13 64921218 missense probably benign
IGL02377:Spata31 APN 13 64920380 missense probably damaging 0.98
IGL02723:Spata31 APN 13 64920649 missense probably benign 0.10
IGL03125:Spata31 APN 13 64920889 missense probably benign 0.09
IGL03343:Spata31 APN 13 64919773 missense probably benign 0.41
F5770:Spata31 UTSW 13 64921648 missense probably benign 0.18
IGL02991:Spata31 UTSW 13 64920719 missense probably benign 0.05
P0043:Spata31 UTSW 13 64921006 unclassified probably null
PIT4366001:Spata31 UTSW 13 64921505 nonsense probably null
PIT4458001:Spata31 UTSW 13 64921850 missense probably benign 0.01
PIT4687001:Spata31 UTSW 13 64921337 missense probably benign 0.02
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0639:Spata31 UTSW 13 64922213 missense probably benign 0.02
R1253:Spata31 UTSW 13 64922024 missense probably benign 0.23
R1536:Spata31 UTSW 13 64921382 missense probably damaging 1.00
R1656:Spata31 UTSW 13 64921139 missense probably benign
R1802:Spata31 UTSW 13 64922383 missense probably benign 0.01
R1813:Spata31 UTSW 13 64921798 missense probably benign 0.32
R1916:Spata31 UTSW 13 64922545 nonsense probably null
R1917:Spata31 UTSW 13 64920865 missense possibly damaging 0.92
R1933:Spata31 UTSW 13 64920610 missense probably benign 0.02
R2910:Spata31 UTSW 13 64920436 missense probably benign 0.12
R3750:Spata31 UTSW 13 64921743 missense probably benign 0.01
R3876:Spata31 UTSW 13 64920931 missense probably benign 0.03
R3980:Spata31 UTSW 13 64922654 missense probably benign 0.24
R4300:Spata31 UTSW 13 64919761 missense probably benign 0.08
R4797:Spata31 UTSW 13 64922742 nonsense probably null
R4997:Spata31 UTSW 13 64919723 missense probably benign 0.00
R5185:Spata31 UTSW 13 64917526 missense possibly damaging 0.93
R5366:Spata31 UTSW 13 64920459 missense probably damaging 0.98
R5539:Spata31 UTSW 13 64922969 missense probably benign 0.00
R5704:Spata31 UTSW 13 64922041 missense probably benign 0.32
R5748:Spata31 UTSW 13 64920313 makesense probably null
R5834:Spata31 UTSW 13 64922666 missense probably benign 0.19
R5926:Spata31 UTSW 13 64920725 missense possibly damaging 0.82
R6476:Spata31 UTSW 13 64917642 missense possibly damaging 0.68
R6603:Spata31 UTSW 13 64922665 missense probably damaging 1.00
R6620:Spata31 UTSW 13 64919757 missense possibly damaging 0.68
R6965:Spata31 UTSW 13 64922834 missense possibly damaging 0.90
R7086:Spata31 UTSW 13 64922229 missense probably benign 0.02
R7140:Spata31 UTSW 13 64921099 missense probably benign
V7580:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7581:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7583:Spata31 UTSW 13 64921648 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCAAAGTCCATGTGCTCTTCAG -3'
(R):5'- CCACACTCTGGTTTGGTTGG -3'

Sequencing Primer
(F):5'- AGTCCATGTGCTCTTCAGAGAAGC -3'
(R):5'- CTGTAGAAGGCTCATGGTCAACAC -3'
Posted On2015-04-30