Incidental Mutation 'R4056:Zfyve16'
ID314266
Institutional Source Beutler Lab
Gene Symbol Zfyve16
Ensembl Gene ENSMUSG00000021706
Gene Namezinc finger, FYVE domain containing 16
SynonymsB130024H06Rik
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92487108-92530868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92504549 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1229 (N1229S)
Ref Sequence ENSEMBL: ENSMUSP00000022217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022217]
Predicted Effect probably damaging
Transcript: ENSMUST00000022217
AA Change: N1229S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022217
Gene: ENSMUSG00000021706
AA Change: N1229S

DomainStartEndE-ValueType
low complexity region 163 175 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 455 484 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
FYVE 727 794 7.25e-31 SMART
low complexity region 821 838 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
Pfam:DUF3480 1155 1503 3.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156586
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Other mutations in Zfyve16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfyve16 APN 13 92516538 missense possibly damaging 0.56
IGL00737:Zfyve16 APN 13 92521118 nonsense probably null
IGL00741:Zfyve16 APN 13 92524253 missense probably damaging 1.00
IGL00753:Zfyve16 APN 13 92521118 nonsense probably null
IGL01123:Zfyve16 APN 13 92492522 missense probably damaging 1.00
IGL01149:Zfyve16 APN 13 92508283 missense probably damaging 1.00
IGL01414:Zfyve16 APN 13 92522196 missense probably benign 0.04
IGL01771:Zfyve16 APN 13 92522172 missense probably benign 0.38
IGL01889:Zfyve16 APN 13 92522569 missense possibly damaging 0.87
IGL01928:Zfyve16 APN 13 92504498 missense probably damaging 0.97
IGL02524:Zfyve16 APN 13 92504514 missense probably benign 0.19
IGL03102:Zfyve16 APN 13 92511817 missense possibly damaging 0.57
IGL03192:Zfyve16 APN 13 92521240 missense possibly damaging 0.94
PIT4151001:Zfyve16 UTSW 13 92521204 missense probably damaging 0.99
R0321:Zfyve16 UTSW 13 92492534 missense probably damaging 0.99
R0548:Zfyve16 UTSW 13 92494944 missense probably benign 0.00
R0555:Zfyve16 UTSW 13 92516520 splice site probably benign
R0616:Zfyve16 UTSW 13 92521129 missense probably damaging 1.00
R0727:Zfyve16 UTSW 13 92493878 missense possibly damaging 0.81
R0730:Zfyve16 UTSW 13 92521477 missense probably damaging 0.98
R1221:Zfyve16 UTSW 13 92508305 missense possibly damaging 0.87
R1297:Zfyve16 UTSW 13 92522332 missense probably benign 0.41
R1597:Zfyve16 UTSW 13 92508247 missense probably benign 0.02
R1635:Zfyve16 UTSW 13 92509020 missense probably damaging 1.00
R1803:Zfyve16 UTSW 13 92504085 missense probably damaging 1.00
R1840:Zfyve16 UTSW 13 92511525 missense possibly damaging 0.79
R1962:Zfyve16 UTSW 13 92522744 missense possibly damaging 0.74
R2029:Zfyve16 UTSW 13 92504477 missense probably damaging 0.98
R2083:Zfyve16 UTSW 13 92524262 missense probably damaging 1.00
R2122:Zfyve16 UTSW 13 92519483 nonsense probably null
R2173:Zfyve16 UTSW 13 92495088 missense probably damaging 0.99
R3822:Zfyve16 UTSW 13 92521261 missense probably damaging 1.00
R3857:Zfyve16 UTSW 13 92494971 missense probably damaging 1.00
R4043:Zfyve16 UTSW 13 92513763 intron probably null
R4495:Zfyve16 UTSW 13 92488567 missense probably benign 0.25
R4518:Zfyve16 UTSW 13 92521312 missense possibly damaging 0.86
R4835:Zfyve16 UTSW 13 92522185 missense probably benign 0.18
R4862:Zfyve16 UTSW 13 92508256 missense probably damaging 1.00
R4962:Zfyve16 UTSW 13 92513894 missense probably damaging 1.00
R5117:Zfyve16 UTSW 13 92505689 missense possibly damaging 0.95
R5344:Zfyve16 UTSW 13 92521588 missense possibly damaging 0.79
R5358:Zfyve16 UTSW 13 92508263 missense probably benign 0.04
R5407:Zfyve16 UTSW 13 92500284 missense probably damaging 1.00
R5410:Zfyve16 UTSW 13 92521231 missense probably benign 0.08
R5704:Zfyve16 UTSW 13 92504471 splice site probably null
R5731:Zfyve16 UTSW 13 92508193 missense probably benign 0.11
R5808:Zfyve16 UTSW 13 92495055 nonsense probably null
R5828:Zfyve16 UTSW 13 92513902 missense probably damaging 1.00
R5928:Zfyve16 UTSW 13 92522117 missense probably benign 0.01
R6044:Zfyve16 UTSW 13 92522666 nonsense probably null
R6141:Zfyve16 UTSW 13 92511597 missense probably benign 0.00
R6538:Zfyve16 UTSW 13 92504516 missense probably damaging 1.00
R6594:Zfyve16 UTSW 13 92513818 missense probably benign 0.23
R6767:Zfyve16 UTSW 13 92508199 missense probably damaging 1.00
R6942:Zfyve16 UTSW 13 92516631 missense probably benign
R7011:Zfyve16 UTSW 13 92521987 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTAGTCTAAACAACTCCTTGGG -3'
(R):5'- AGAGCAGTCTCCACACACTG -3'

Sequencing Primer
(F):5'- AACAACTCCTTGGGAATTTAACC -3'
(R):5'- GCAGTCTCCACACACTGTAAACTTC -3'
Posted On2015-04-30