Incidental Mutation 'R4056:Iqgap2'
ID314267
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95750033 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: V114A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: V114A

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGCCATATGTGTCCCTGG -3'
(R):5'- ACGAGAGTGTTACTGAAATGCTG -3'

Sequencing Primer
(F):5'- GGATAGGCCTTTCCATATCTCAAG -3'
(R):5'- ACTGAAATGCTGTCTAGTCTTCTG -3'
Posted On2015-04-30