Incidental Mutation 'R4056:Pros1'
ID314270
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Nameprotein S (alpha)
Synonymsprotein S
MMRRC Submission 041617-MU
Accession Numbers

Genbank: NM_011173; MGI: 1095733  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location62854307-62929346 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 62900645 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 188 (R188*)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
Predicted Effect probably null
Transcript: ENSMUST00000023629
AA Change: R188*
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: R188*

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155940
Meta Mutation Damage Score 0.6328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62903518 missense probably benign 0.03
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1308:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62913848 missense probably damaging 0.99
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7055:Pros1 UTSW 16 62928102 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGCCAAGCTGCTTTTACTTGC -3'
(R):5'- TTCCTCGTGGACATAGAGGC -3'

Sequencing Primer
(F):5'- TTCTGTAAGCCCGGCTGG -3'
(R):5'- CTCGTGGACATAGAGGCACATTTC -3'
Posted On2015-04-30