Incidental Mutation 'R4056:Abcf1'
ID314271
Institutional Source Beutler Lab
Gene Symbol Abcf1
Ensembl Gene ENSMUSG00000038762
Gene NameATP-binding cassette, sub-family F (GCN20), member 1
SynonymsGCN20, D17Wsu166e, Abc50
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35956819-35969761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35959915 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 510 (I510T)
Ref Sequence ENSEMBL: ENSMUSP00000036881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043757] [ENSMUST00000172661] [ENSMUST00000174128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043757
AA Change: I510T

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036881
Gene: ENSMUSG00000038762
AA Change: I510T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
coiled coil region 46 79 N/A INTRINSIC
low complexity region 173 208 N/A INTRINSIC
low complexity region 218 234 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
AAA 320 524 9e-10 SMART
low complexity region 529 554 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
AAA 642 807 1.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104738
Predicted Effect probably benign
Transcript: ENSMUST00000172661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173125
Predicted Effect probably benign
Transcript: ENSMUST00000174128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174834
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the GCN20 subfamily. Unlike other members of the superfamily, this protein lacks the transmembrane domains which are characteristic of most ABC transporters. This protein may be regulated by tumor necrosis factor-alpha and play a role in enhancement of protein synthesis and the inflammation process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Abcf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Abcf1 APN 17 35964010 missense probably damaging 1.00
IGL02008:Abcf1 APN 17 35962062 missense probably benign
IGL02209:Abcf1 APN 17 35964009 missense probably damaging 0.99
IGL02218:Abcf1 APN 17 35958338 missense probably benign 0.00
IGL02455:Abcf1 APN 17 35960129 missense probably damaging 1.00
IGL03238:Abcf1 APN 17 35963323 missense probably damaging 0.99
bamboo UTSW 17 35958062 splice site probably benign
IGL02837:Abcf1 UTSW 17 35957581 missense probably benign
R0007:Abcf1 UTSW 17 35959670 missense probably damaging 0.99
R0078:Abcf1 UTSW 17 35958062 splice site probably benign
R0617:Abcf1 UTSW 17 35961187 missense probably benign 0.00
R0655:Abcf1 UTSW 17 35957845 missense probably benign 0.20
R1421:Abcf1 UTSW 17 35960909 missense probably damaging 1.00
R1879:Abcf1 UTSW 17 35961812 missense probably benign 0.13
R3433:Abcf1 UTSW 17 35958217 missense probably benign 0.36
R3915:Abcf1 UTSW 17 35959510 missense possibly damaging 0.46
R4057:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4114:Abcf1 UTSW 17 35959254 missense probably benign 0.25
R4709:Abcf1 UTSW 17 35960177 missense probably damaging 1.00
R4722:Abcf1 UTSW 17 35958041 intron probably benign
R4932:Abcf1 UTSW 17 35959450 missense possibly damaging 0.62
R5129:Abcf1 UTSW 17 35960795 unclassified probably benign
R5255:Abcf1 UTSW 17 35959737 intron probably null
R5517:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5518:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5660:Abcf1 UTSW 17 35963647 missense possibly damaging 0.87
R5836:Abcf1 UTSW 17 35962026 missense possibly damaging 0.77
R6193:Abcf1 UTSW 17 35963572 missense possibly damaging 0.77
R6247:Abcf1 UTSW 17 35961064 missense probably damaging 1.00
R6257:Abcf1 UTSW 17 35961182 missense probably benign 0.10
R6876:Abcf1 UTSW 17 35959244 missense probably benign 0.45
R7095:Abcf1 UTSW 17 35957511 missense possibly damaging 0.81
R7134:Abcf1 UTSW 17 35959252 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTCTTGAAGGTCACTGGGG -3'
(R):5'- TGGCTCAATAAGTGCGCTGC -3'

Sequencing Primer
(F):5'- TTGAAGGTCACTGGGGTGGAAC -3'
(R):5'- AATAAGTGCGCTGCCCGTG -3'
Posted On2015-04-30