Incidental Mutation 'R4056:Hpse2'
ID314272
Institutional Source Beutler Lab
Gene Symbol Hpse2
Ensembl Gene ENSMUSG00000074852
Gene Nameheparanase 2
SynonymsLOC381226
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location42788947-43388311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43294275 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 180 (K180E)
Ref Sequence ENSEMBL: ENSMUSP00000097026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099428]
Predicted Effect probably damaging
Transcript: ENSMUST00000099428
AA Change: K180E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097026
Gene: ENSMUSG00000074852
AA Change: K180E

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Glyco_hydro_79n 168 408 6.6e-22 PFAM
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heparanase enzyme. The encoded protein is a endoglycosidase that degrades heparin sulfate proteoglycans located on the extracellular matrix and cell surface. This protein may be involved in biological processes involving remodeling of the extracellular matrix including angiogenesis and tumor progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit growth retardation, a distended urinary bladder, abnormal voiding behavior, proteinuria, renal dysfunction and malnutrition, reduced cell proliferation, urinary bladder fibrosis, and lethality within one month of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Hpse2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Hpse2 APN 19 43384789 missense probably benign
IGL02315:Hpse2 APN 19 42966947 splice site probably benign
IGL02324:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02328:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02388:Hpse2 APN 19 43294253 missense probably damaging 1.00
IGL02977:Hpse2 APN 19 42789122 splice site probably benign
R0147:Hpse2 UTSW 19 42931660 splice site probably null
R0148:Hpse2 UTSW 19 42931660 splice site probably null
R0472:Hpse2 UTSW 19 43013163 missense probably damaging 0.99
R0892:Hpse2 UTSW 19 43388146 missense probably benign 0.31
R1033:Hpse2 UTSW 19 42913199 missense probably benign 0.41
R1242:Hpse2 UTSW 19 42966977 missense probably benign 0.00
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1611:Hpse2 UTSW 19 42789065 missense probably damaging 1.00
R2382:Hpse2 UTSW 19 42931622 missense probably benign 0.04
R2496:Hpse2 UTSW 19 43013043 critical splice donor site probably null
R2982:Hpse2 UTSW 19 43384743 missense probably null 0.99
R4057:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4434:Hpse2 UTSW 19 43294269 missense probably benign 0.00
R4762:Hpse2 UTSW 19 42789071 missense possibly damaging 0.52
R4856:Hpse2 UTSW 19 42788957 missense probably damaging 1.00
R4886:Hpse2 UTSW 19 43384764 missense probably damaging 1.00
R5018:Hpse2 UTSW 19 43384824 missense possibly damaging 0.57
R6289:Hpse2 UTSW 19 42788979 missense probably null 1.00
R6382:Hpse2 UTSW 19 43388202 missense possibly damaging 0.93
R6805:Hpse2 UTSW 19 43294321 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTGGGCTCATCTGGATGC -3'
(R):5'- ATGGAACTAAAGGACCTTCAGG -3'

Sequencing Primer
(F):5'- GCTCATCTGGATGCCACACTAG -3'
(R):5'- TCTGTCATGCTGGATAAAAC -3'
Posted On2015-04-30