Incidental Mutation 'R4057:Ints2'
ID314296
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4057 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86242952 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 424 (L424R)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: L424R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: L424R

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: L424R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: L424R

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,025 M1686K probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Asb2 A G 12: 103,325,394 Y377H probably benign Het
Cars T C 7: 143,570,648 E347G probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst T C 1: 34,186,054 probably benign Het
Emcn C A 3: 137,379,899 T86K probably damaging Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Hmcn2 A G 2: 31,400,238 Y2361C probably damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Ltbp1 G T 17: 75,310,194 G725C probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Myo3a T A 2: 22,266,160 M144K probably benign Het
Nav3 A T 10: 109,880,533 probably null Het
Neb A T 2: 52,206,699 V5000D possibly damaging Het
Neb G T 2: 52,237,108 A3534E probably benign Het
Nlrp9a T A 7: 26,570,646 C833S probably benign Het
Npas1 C A 7: 16,474,787 R55L probably damaging Het
Olfr659 A G 7: 104,671,269 K189R probably damaging Het
P2ry10 T C X: 107,103,256 C266R probably damaging Het
Pcdh1 T C 18: 38,198,897 E351G probably damaging Het
Plce1 A T 19: 38,760,119 R1751W probably damaging Het
Plekhn1 T C 4: 156,224,693 probably null Het
Por A G 5: 135,731,574 Y245C probably damaging Het
Ptprm A C 17: 67,075,663 I158S possibly damaging Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Serpina3m A C 12: 104,391,737 probably benign Het
Sox5 G T 6: 144,116,522 R135S probably damaging Het
Stag2 A G X: 42,224,942 T228A probably damaging Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACACCCTTATTGGTAGTAACACTC -3'
(R):5'- TGTGTGCTACTCACCTGCAG -3'

Sequencing Primer
(F):5'- GGTAGTAACACTCCTTCTAGGCG -3'
(R):5'- CAGTGCGGTTAAAAAGTTTGC -3'
Posted On2015-04-30