Incidental Mutation 'R4059:Tmpo'
ID314394
Institutional Source Beutler Lab
Gene Symbol Tmpo
Ensembl Gene ENSMUSG00000019961
Gene Namethymopoietin
Synonymslamina-associated polypeptide 2, TP, LAP2, 5630400D24Rik
MMRRC Submission 040970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4059 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location91147571-91181315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91162261 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 555 (S555P)
Ref Sequence ENSEMBL: ENSMUSP00000020123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020123] [ENSMUST00000072239] [ENSMUST00000092219] [ENSMUST00000099355] [ENSMUST00000105293]
PDB Structure
THE DIMERIZATION DOMAIN OF LAP2ALPHA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020123
AA Change: S555P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000020123
Gene: ENSMUSG00000019961
AA Change: S555P

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 189 197 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
Pfam:LAP2alpha 459 692 6.4e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072239
SMART Domains Protein: ENSMUSP00000072092
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 226 240 N/A INTRINSIC
transmembrane domain 410 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092219
SMART Domains Protein: ENSMUSP00000089864
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099355
SMART Domains Protein: ENSMUSP00000096956
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105293
SMART Domains Protein: ENSMUSP00000100930
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 301 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217449
Meta Mutation Damage Score 0.0504 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous null for a protein isoform generated from this locus have hyperproliferation of epidermal and erythroid progenitor cells that leads to thickened paws and increased crypt lengths in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Agbl3 T C 6: 34,846,899 L833P probably damaging Het
Amph T C 13: 19,141,998 S633P probably damaging Het
Aspscr1 T C 11: 120,686,679 V60A probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
BC051019 C T 7: 109,717,995 W163* probably null Het
Capza1 T C 3: 104,825,111 E245G probably damaging Het
Cd81 G T 7: 143,065,293 C18F probably damaging Het
Cfap45 G T 1: 172,538,489 R303L probably benign Het
Commd9 T C 2: 101,895,154 V24A possibly damaging Het
Dennd4a A G 9: 64,911,892 N1742D possibly damaging Het
Dgat1 G T 15: 76,504,171 A182D possibly damaging Het
Dlg4 T C 11: 70,027,083 L64P probably benign Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Epb41l4b C T 4: 57,024,337 probably null Het
Fam13c T C 10: 70,554,508 L533P probably damaging Het
Fjx1 T C 2: 102,450,721 T290A possibly damaging Het
Hid1 C T 11: 115,356,739 E278K probably damaging Het
Hsd3b7 T C 7: 127,801,545 I57T probably damaging Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Itgae A G 11: 73,112,134 K175E probably benign Het
Klhl32 T C 4: 24,792,781 T14A probably damaging Het
Krt23 T C 11: 99,485,788 T181A probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc36 A G 8: 105,427,796 E33G probably damaging Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mocos G A 18: 24,679,390 G447D probably damaging Het
Ngef T A 1: 87,486,231 K399N probably damaging Het
Ntrk1 A G 3: 87,781,479 L589P probably damaging Het
Olfr1199 C T 2: 88,756,451 V75I probably benign Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Peg10 T G 6: 4,756,427 probably benign Het
Pkhd1l1 C T 15: 44,550,760 H2808Y probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Ptcd2 A G 13: 99,344,576 C32R probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhoh G A 5: 65,892,588 S67N probably benign Het
Rnd3 A G 2: 51,148,748 F43L probably damaging Het
Runx1 A G 16: 92,644,246 V225A probably benign Het
Runx1t1 T C 4: 13,889,769 V566A probably benign Het
Sall2 A G 14: 52,314,571 I387T probably damaging Het
Sec14l1 T A 11: 117,149,198 V384D possibly damaging Het
Sh3rf3 T C 10: 59,083,533 C491R probably damaging Het
Slc22a27 T A 19: 7,879,608 probably benign Het
Spire1 A G 18: 67,545,713 S53P probably damaging Het
Tmco3 A G 8: 13,320,848 R671G probably benign Het
Tnip1 A G 11: 54,911,569 S638P probably benign Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Ucp3 T C 7: 100,482,664 Y241H probably damaging Het
Vmn2r96 A G 17: 18,598,077 I831V probably benign Het
Zan T C 5: 137,436,820 I2104V unknown Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Zfp715 T C 7: 43,301,731 M48V probably benign Het
Other mutations in Tmpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Tmpo APN 10 91164206 splice site probably benign
IGL00791:Tmpo APN 10 91162558 missense possibly damaging 0.94
IGL00919:Tmpo APN 10 91162800 missense probably damaging 0.99
IGL01382:Tmpo APN 10 91166050 missense probably damaging 1.00
IGL01806:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01813:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01838:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01952:Tmpo APN 10 91163242 missense probably benign 0.01
IGL02110:Tmpo APN 10 91162865 missense probably damaging 1.00
IGL02122:Tmpo APN 10 91164136 missense possibly damaging 0.77
IGL02191:Tmpo APN 10 91161879 missense probably benign 0.00
IGL02338:Tmpo APN 10 91163242 missense probably benign 0.01
PIT4366001:Tmpo UTSW 10 91163310 missense probably damaging 1.00
PIT4544001:Tmpo UTSW 10 91162114 missense probably benign
R0133:Tmpo UTSW 10 91164038 splice site probably benign
R0450:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0469:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0836:Tmpo UTSW 10 91161953 nonsense probably null
R2405:Tmpo UTSW 10 91163354 missense probably damaging 1.00
R2919:Tmpo UTSW 10 91152686 missense probably benign 0.23
R4296:Tmpo UTSW 10 91162956 missense possibly damaging 0.49
R4741:Tmpo UTSW 10 91162644 missense probably benign 0.18
R4881:Tmpo UTSW 10 91162641 missense possibly damaging 0.93
R4915:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4917:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4960:Tmpo UTSW 10 91153309 missense probably damaging 1.00
R5002:Tmpo UTSW 10 91164114 missense possibly damaging 0.76
R5301:Tmpo UTSW 10 91149788 intron probably benign
R6167:Tmpo UTSW 10 91162938 missense probably benign
R6190:Tmpo UTSW 10 91164207 splice site probably null
R6979:Tmpo UTSW 10 91152497 intron probably null
Predicted Primers PCR Primer
(F):5'- AATCCTGAGTGCCTGCTGTG -3'
(R):5'- TAAAATAGAAGCCTCAGAGCCGTC -3'

Sequencing Primer
(F):5'- AGTGCCTGCTGTGCATCACTAG -3'
(R):5'- CCACGAATCTATCCTAAAAGTGGTGG -3'
Posted On2015-04-30