Incidental Mutation 'R4059:Vmn2r96'
ID314411
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Namevomeronasal 2, receptor 96
SynonymsEG433070
MMRRC Submission 040970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4059 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18573151-18616003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18598077 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 831 (I831V)
Ref Sequence ENSEMBL: ENSMUSP00000156012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
Predicted Effect probably benign
Transcript: ENSMUST00000165692
AA Change: I639V

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: I639V

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177244
AA Change: I831V

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: I831V

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably benign
Transcript: ENSMUST00000231286
AA Change: I831V

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Agbl3 T C 6: 34,846,899 L833P probably damaging Het
Amph T C 13: 19,141,998 S633P probably damaging Het
Aspscr1 T C 11: 120,686,679 V60A probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
BC051019 C T 7: 109,717,995 W163* probably null Het
Capza1 T C 3: 104,825,111 E245G probably damaging Het
Cd81 G T 7: 143,065,293 C18F probably damaging Het
Cfap45 G T 1: 172,538,489 R303L probably benign Het
Commd9 T C 2: 101,895,154 V24A possibly damaging Het
Dennd4a A G 9: 64,911,892 N1742D possibly damaging Het
Dgat1 G T 15: 76,504,171 A182D possibly damaging Het
Dlg4 T C 11: 70,027,083 L64P probably benign Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Epb41l4b C T 4: 57,024,337 probably null Het
Fam13c T C 10: 70,554,508 L533P probably damaging Het
Fjx1 T C 2: 102,450,721 T290A possibly damaging Het
Hid1 C T 11: 115,356,739 E278K probably damaging Het
Hsd3b7 T C 7: 127,801,545 I57T probably damaging Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Itgae A G 11: 73,112,134 K175E probably benign Het
Klhl32 T C 4: 24,792,781 T14A probably damaging Het
Krt23 T C 11: 99,485,788 T181A probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc36 A G 8: 105,427,796 E33G probably damaging Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mocos G A 18: 24,679,390 G447D probably damaging Het
Ngef T A 1: 87,486,231 K399N probably damaging Het
Ntrk1 A G 3: 87,781,479 L589P probably damaging Het
Olfr1199 C T 2: 88,756,451 V75I probably benign Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Peg10 T G 6: 4,756,427 probably benign Het
Pkhd1l1 C T 15: 44,550,760 H2808Y probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Ptcd2 A G 13: 99,344,576 C32R probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhoh G A 5: 65,892,588 S67N probably benign Het
Rnd3 A G 2: 51,148,748 F43L probably damaging Het
Runx1 A G 16: 92,644,246 V225A probably benign Het
Runx1t1 T C 4: 13,889,769 V566A probably benign Het
Sall2 A G 14: 52,314,571 I387T probably damaging Het
Sec14l1 T A 11: 117,149,198 V384D possibly damaging Het
Sh3rf3 T C 10: 59,083,533 C491R probably damaging Het
Slc22a27 T A 19: 7,879,608 probably benign Het
Spire1 A G 18: 67,545,713 S53P probably damaging Het
Tmco3 A G 8: 13,320,848 R671G probably benign Het
Tmpo A G 10: 91,162,261 S555P probably benign Het
Tnip1 A G 11: 54,911,569 S638P probably benign Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Ucp3 T C 7: 100,482,664 Y241H probably damaging Het
Zan T C 5: 137,436,820 I2104V unknown Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Zfp715 T C 7: 43,301,731 M48V probably benign Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18583819 missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18582964 missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18597265 missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18583959 missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18597567 missense probably benign
IGL02672:Vmn2r96 APN 17 18598114 missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18582589 missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18582875 missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18586372 missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18582565 missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18584000 missense probably benign
R0580:Vmn2r96 UTSW 17 18582638 missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18597568 missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18582476 missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18597726 missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18582653 missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18597921 missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18586402 missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18583876 missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18584001 missense probably benign
R2405:Vmn2r96 UTSW 17 18597840 missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R4693:Vmn2r96 UTSW 17 18583008 missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18582826 missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18597508 missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18597604 missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18582656 missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18583858 missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18597688 missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18597829 missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18583959 missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18583864 missense probably benign
R6339:Vmn2r96 UTSW 17 18583862 missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18597531 missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18583855 missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18598090 missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18581854 missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18582538 missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18597629 missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18597838 missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18598021 missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18583820 missense probably benign
R7149:Vmn2r96 UTSW 17 18597727 missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18582767 missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18583040 missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18573400 missense probably benign 0.02
Z1088:Vmn2r96 UTSW 17 18597366 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCCTTCTTGTCTAGAAATTTGCCAG -3'
(R):5'- AGGAATGGAGCCATCAGGTC -3'

Sequencing Primer
(F):5'- CAGCACTAAAGGGAAGGTC -3'
(R):5'- GGAGCCATCAGGTCTTATACTCAG -3'
Posted On2015-04-30