Incidental Mutation 'R4113:Tssk4'
ID314520
Institutional Source Beutler Lab
Gene Symbol Tssk4
Ensembl Gene ENSMUSG00000007591
Gene Nametestis-specific serine kinase 4
Synonyms1700020B19Rik, 4933424F08Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55650184-55652539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55650373 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 9 (T9A)
Ref Sequence ENSEMBL: ENSMUSP00000154143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007735] [ENSMUST00000164809] [ENSMUST00000226497] [ENSMUST00000226591] [ENSMUST00000227297] [ENSMUST00000228041] [ENSMUST00000228395]
Predicted Effect probably benign
Transcript: ENSMUST00000007735
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007735
Gene: ENSMUSG00000007591
AA Change: T9A

DomainStartEndE-ValueType
Pfam:Pkinase 25 280 1.1e-54 PFAM
Pfam:Pkinase_Tyr 25 280 7.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164809
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127728
Gene: ENSMUSG00000007591
AA Change: T9A

DomainStartEndE-ValueType
Pfam:Pkinase 25 281 4e-56 PFAM
Pfam:Pkinase_Tyr 25 281 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226497
AA Change: T9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226591
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227297
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228007
Predicted Effect probably benign
Transcript: ENSMUST00000228041
AA Change: T9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228395
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the testis-specific serine/threonine kinase family. The encoded protein is thought to be involved in spermatogenesis via stimulation of the CREB/CRE responsive pathway through phosphorylation of the cAMP responsive element binding protein transcription factor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Tssk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Tssk4 APN 14 55650553 missense probably damaging 1.00
IGL02943:Tssk4 APN 14 55651566 missense probably damaging 1.00
IGL03082:Tssk4 APN 14 55651061 missense probably damaging 1.00
IGL03281:Tssk4 APN 14 55650428 missense possibly damaging 0.86
R0201:Tssk4 UTSW 14 55651559 nonsense probably null
R0201:Tssk4 UTSW 14 55651560 missense probably damaging 1.00
R1655:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R1660:Tssk4 UTSW 14 55650572 missense probably null 0.90
R1743:Tssk4 UTSW 14 55651031 missense probably damaging 1.00
R2103:Tssk4 UTSW 14 55651540 missense probably damaging 1.00
R3431:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R3432:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R4870:Tssk4 UTSW 14 55651815 missense probably benign 0.38
R4957:Tssk4 UTSW 14 55651809 missense probably damaging 1.00
R5147:Tssk4 UTSW 14 55650973 missense possibly damaging 0.56
R6785:Tssk4 UTSW 14 55650475 missense probably damaging 1.00
R6917:Tssk4 UTSW 14 55652407 missense probably benign 0.13
Z1088:Tssk4 UTSW 14 55650923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGTTCTTAGTGAAGGGC -3'
(R):5'- TTCTGACCTGTATCTCACGTGG -3'

Sequencing Primer
(F):5'- TCTTAGTGAAGGGCCGAGC -3'
(R):5'- ACCTGTATCTCACGTGGTAGGAAC -3'
Posted On2015-05-14