Incidental Mutation 'R4114:Dpp6'
ID314543
Institutional Source Beutler Lab
Gene Symbol Dpp6
Ensembl Gene ENSMUSG00000061576
Gene Namedipeptidylpeptidase 6
SynonymsRw, LOC384168, Peplb, Dpp-6, B930011P16Rik, In(5)6H-p
MMRRC Submission 040990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4114 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location26817203-27727505 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 27469487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
Predicted Effect probably null
Transcript: ENSMUST00000071500
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101471
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120555
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122171
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Meta Mutation Damage Score 0.514 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,297,910 V935A probably damaging Het
6030468B19Rik T G 11: 117,802,967 S87A probably damaging Het
Abca16 T C 7: 120,527,067 F1149L probably benign Het
Abcf1 A T 17: 35,959,254 D637E probably benign Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
C87977 A T 4: 144,209,603 L29H probably damaging Het
Cdh23 A G 10: 60,421,040 probably null Het
Cep44 T C 8: 56,545,422 T74A probably benign Het
Colq T A 14: 31,557,867 M1L probably benign Het
Cym A T 3: 107,219,749 L30Q probably damaging Het
Gbe1 G T 16: 70,483,827 G372V possibly damaging Het
Hdc T A 2: 126,601,818 M314L probably benign Het
Ino80b A G 6: 83,124,140 S149P probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nlrp4a T G 7: 26,449,940 F324C probably damaging Het
Nop56 T C 2: 130,276,673 probably null Het
Olfr1044 A T 2: 86,171,415 V134D possibly damaging Het
Olfr804 T C 10: 129,705,799 L307S probably benign Het
Pcdhb3 A G 18: 37,302,040 N353S probably benign Het
Pde8a T A 7: 81,282,807 probably null Het
Ryr2 C T 13: 11,692,682 R2823H probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Slc7a1 T C 5: 148,342,057 T302A probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trim5 A G 7: 104,265,740 L374P probably damaging Het
Tspan18 C A 2: 93,311,946 probably null Het
Vmn2r37 T A 7: 9,210,093 probably null Het
Zbbx T C 3: 75,139,598 T121A probably benign Het
Zfp35 A C 18: 24,002,709 I37L probably benign Het
Other mutations in Dpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Dpp6 APN 5 27723443 missense probably damaging 1.00
IGL01137:Dpp6 APN 5 27714488 missense probably damaging 1.00
IGL01386:Dpp6 APN 5 27664762 critical splice donor site probably null
IGL01409:Dpp6 APN 5 27557601 missense probably damaging 1.00
IGL01721:Dpp6 APN 5 27631520 missense probably damaging 1.00
IGL02149:Dpp6 APN 5 27538024 missense probably benign 0.00
IGL02174:Dpp6 APN 5 27721087 nonsense probably null
IGL02176:Dpp6 APN 5 27723577 missense probably damaging 0.98
IGL02326:Dpp6 APN 5 27664757 missense probably damaging 1.00
IGL02336:Dpp6 APN 5 27469411 missense probably benign 0.04
IGL02339:Dpp6 APN 5 27652230 missense probably damaging 0.97
IGL02402:Dpp6 APN 5 27634543 missense probably damaging 1.00
IGL02884:Dpp6 APN 5 27634556 missense possibly damaging 0.88
IGL02885:Dpp6 APN 5 27718473 missense probably damaging 1.00
IGL02938:Dpp6 APN 5 27723367 splice site probably benign
IGL03083:Dpp6 APN 5 27709550 critical splice donor site probably null
I0000:Dpp6 UTSW 5 27398922 missense probably benign 0.02
IGL03052:Dpp6 UTSW 5 27709508 missense probably benign 0.03
PIT4431001:Dpp6 UTSW 5 27631498 missense probably benign 0.03
R0060:Dpp6 UTSW 5 27598819 missense probably damaging 1.00
R0360:Dpp6 UTSW 5 27652269 missense probably damaging 1.00
R0486:Dpp6 UTSW 5 27661642 missense probably benign 0.39
R0501:Dpp6 UTSW 5 27725606 missense probably damaging 1.00
R1028:Dpp6 UTSW 5 27666427 missense probably benign 0.01
R1164:Dpp6 UTSW 5 27721105 missense probably benign 0.02
R1177:Dpp6 UTSW 5 27663473 missense possibly damaging 0.94
R1993:Dpp6 UTSW 5 27399006 missense probably benign 0.00
R2024:Dpp6 UTSW 5 27709459 missense possibly damaging 0.67
R2100:Dpp6 UTSW 5 27664744 missense probably damaging 0.96
R2329:Dpp6 UTSW 5 27451288 splice site probably null
R3619:Dpp6 UTSW 5 27721120 missense possibly damaging 0.74
R3871:Dpp6 UTSW 5 27469465 missense probably benign 0.03
R3872:Dpp6 UTSW 5 27721058 missense probably damaging 1.00
R4403:Dpp6 UTSW 5 27718462 missense probably damaging 1.00
R4599:Dpp6 UTSW 5 27634548 missense probably damaging 1.00
R4736:Dpp6 UTSW 5 27712659 missense probably damaging 1.00
R4929:Dpp6 UTSW 5 27049787 missense probably benign 0.25
R4967:Dpp6 UTSW 5 27666511 missense probably damaging 1.00
R5162:Dpp6 UTSW 5 27399015 unclassified probably benign
R5270:Dpp6 UTSW 5 27634534 missense probably damaging 0.98
R5334:Dpp6 UTSW 5 27709540 missense probably benign 0.30
R5437:Dpp6 UTSW 5 27663501 nonsense probably null
R5663:Dpp6 UTSW 5 27049622 missense possibly damaging 0.84
R6023:Dpp6 UTSW 5 27723547 missense probably damaging 0.96
R6244:Dpp6 UTSW 5 27049628 missense probably damaging 0.99
R6312:Dpp6 UTSW 5 27725671 missense possibly damaging 0.84
R6442:Dpp6 UTSW 5 27718509 critical splice donor site probably null
R6942:Dpp6 UTSW 5 27469459 missense possibly damaging 0.79
R6956:Dpp6 UTSW 5 27598821 missense probably damaging 1.00
R7210:Dpp6 UTSW 5 27598803 missense probably damaging 0.99
R7342:Dpp6 UTSW 5 27714554 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGAGGATTTTGAGACTAGC -3'
(R):5'- GGAGCCATTGTGTTTCCTACCAAG -3'

Sequencing Primer
(F):5'- GGATTTTGAGACTAGCACCAGAATC -3'
(R):5'- ATTGTGTTTCCTACCAAGAAAAATTG -3'
Posted On2015-05-14