Incidental Mutation 'R4114:Slc7a1'
ID314544
Institutional Source Beutler Lab
Gene Symbol Slc7a1
Ensembl Gene ENSMUSG00000041313
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 1
SynonymsRev-1, Rec-1, Atrc1, Cat1, mCAT-1, 4831426K01Rik, Atrc-1
MMRRC Submission 040990-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4114 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location148327410-148399904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148342057 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 302 (T302A)
Ref Sequence ENSEMBL: ENSMUSP00000117781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048116] [ENSMUST00000138257] [ENSMUST00000202457]
Predicted Effect probably damaging
Transcript: ENSMUST00000048116
AA Change: T302A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046714
Gene: ENSMUSG00000041313
AA Change: T302A

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 440 1.3e-51 PFAM
Pfam:AA_permease 36 431 1.3e-42 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Pfam:AA_permease_C 551 601 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138257
AA Change: T302A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117781
Gene: ENSMUSG00000041313
AA Change: T302A

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 439 6e-52 PFAM
Pfam:AA_permease 36 433 2.3e-43 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201860
Predicted Effect probably benign
Transcript: ENSMUST00000202457
SMART Domains Protein: ENSMUSP00000144000
Gene: ENSMUSG00000041313

DomainStartEndE-ValueType
Pfam:AA_permease 6 142 7.5e-14 PFAM
Pfam:AA_permease_2 11 142 2.7e-16 PFAM
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygous mutants die on the first day of birth and are very anemic. Peripheral blood contains 50% fewer red blood cells, reduced hemoglobin levels, and a defect in erythroid maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,297,910 V935A probably damaging Het
6030468B19Rik T G 11: 117,802,967 S87A probably damaging Het
Abca16 T C 7: 120,527,067 F1149L probably benign Het
Abcf1 A T 17: 35,959,254 D637E probably benign Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
C87977 A T 4: 144,209,603 L29H probably damaging Het
Cdh23 A G 10: 60,421,040 probably null Het
Cep44 T C 8: 56,545,422 T74A probably benign Het
Colq T A 14: 31,557,867 M1L probably benign Het
Cym A T 3: 107,219,749 L30Q probably damaging Het
Dpp6 T A 5: 27,469,487 probably null Het
Gbe1 G T 16: 70,483,827 G372V possibly damaging Het
Hdc T A 2: 126,601,818 M314L probably benign Het
Ino80b A G 6: 83,124,140 S149P probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nlrp4a T G 7: 26,449,940 F324C probably damaging Het
Nop56 T C 2: 130,276,673 probably null Het
Olfr1044 A T 2: 86,171,415 V134D possibly damaging Het
Olfr804 T C 10: 129,705,799 L307S probably benign Het
Pcdhb3 A G 18: 37,302,040 N353S probably benign Het
Pde8a T A 7: 81,282,807 probably null Het
Ryr2 C T 13: 11,692,682 R2823H probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trim5 A G 7: 104,265,740 L374P probably damaging Het
Tspan18 C A 2: 93,311,946 probably null Het
Vmn2r37 T A 7: 9,210,093 probably null Het
Zbbx T C 3: 75,139,598 T121A probably benign Het
Zfp35 A C 18: 24,002,709 I37L probably benign Het
Other mutations in Slc7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc7a1 APN 5 148337192 missense possibly damaging 0.61
H8441:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
R0016:Slc7a1 UTSW 5 148334583 missense probably benign 0.04
R0028:Slc7a1 UTSW 5 148335511 missense probably benign 0.00
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0565:Slc7a1 UTSW 5 148352069 missense probably damaging 1.00
R0696:Slc7a1 UTSW 5 148340556 missense probably benign 0.11
R1338:Slc7a1 UTSW 5 148345936 missense probably damaging 1.00
R1539:Slc7a1 UTSW 5 148335593 missense possibly damaging 0.95
R1926:Slc7a1 UTSW 5 148348303 missense probably damaging 1.00
R2895:Slc7a1 UTSW 5 148340592 missense probably benign 0.06
R2910:Slc7a1 UTSW 5 148352257 missense probably benign 0.00
R3721:Slc7a1 UTSW 5 148335533 nonsense probably null
R3722:Slc7a1 UTSW 5 148335533 nonsense probably null
R4028:Slc7a1 UTSW 5 148345812 missense probably benign 0.01
R4510:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4511:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4600:Slc7a1 UTSW 5 148342059 missense probably damaging 1.00
R4657:Slc7a1 UTSW 5 148352399 missense probably benign
R4723:Slc7a1 UTSW 5 148335440 missense probably damaging 0.99
R5248:Slc7a1 UTSW 5 148333988 missense possibly damaging 0.91
R5697:Slc7a1 UTSW 5 148333982 missense probably benign 0.00
R6027:Slc7a1 UTSW 5 148333964 missense possibly damaging 0.94
R6370:Slc7a1 UTSW 5 148340673 missense probably damaging 1.00
R6847:Slc7a1 UTSW 5 148334658 missense probably benign
V1024:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACAGCTGTATAACATTCCACTGGG -3'
(R):5'- TTAGCCCGTTTGACCTTGCAG -3'

Sequencing Primer
(F):5'- GTATAACATTCCACTGGGCTAAAAC -3'
(R):5'- GAGGATGTGATGCTACGACTACTCC -3'
Posted On2015-05-14