Incidental Mutation 'R4114:Olfr804'
ID314556
Institutional Source Beutler Lab
Gene Symbol Olfr804
Ensembl Gene ENSMUSG00000095401
Gene Nameolfactory receptor 804
SynonymsMOR110-7, GA_x6K02T2PULF-11383575-11384519
MMRRC Submission 040990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4114 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129703210-129710018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129705799 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 307 (L307S)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
Predicted Effect probably benign
Transcript: ENSMUST00000077312
AA Change: L307S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: L307S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213331
AA Change: L307S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216747
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,297,910 V935A probably damaging Het
6030468B19Rik T G 11: 117,802,967 S87A probably damaging Het
Abca16 T C 7: 120,527,067 F1149L probably benign Het
Abcf1 A T 17: 35,959,254 D637E probably benign Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
C87977 A T 4: 144,209,603 L29H probably damaging Het
Cdh23 A G 10: 60,421,040 probably null Het
Cep44 T C 8: 56,545,422 T74A probably benign Het
Colq T A 14: 31,557,867 M1L probably benign Het
Cym A T 3: 107,219,749 L30Q probably damaging Het
Dpp6 T A 5: 27,469,487 probably null Het
Gbe1 G T 16: 70,483,827 G372V possibly damaging Het
Hdc T A 2: 126,601,818 M314L probably benign Het
Ino80b A G 6: 83,124,140 S149P probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nlrp4a T G 7: 26,449,940 F324C probably damaging Het
Nop56 T C 2: 130,276,673 probably null Het
Olfr1044 A T 2: 86,171,415 V134D possibly damaging Het
Pcdhb3 A G 18: 37,302,040 N353S probably benign Het
Pde8a T A 7: 81,282,807 probably null Het
Ryr2 C T 13: 11,692,682 R2823H probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Slc7a1 T C 5: 148,342,057 T302A probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trim5 A G 7: 104,265,740 L374P probably damaging Het
Tspan18 C A 2: 93,311,946 probably null Het
Vmn2r37 T A 7: 9,210,093 probably null Het
Zbbx T C 3: 75,139,598 T121A probably benign Het
Zfp35 A C 18: 24,002,709 I37L probably benign Het
Other mutations in Olfr804
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr804 APN 10 129705623 missense probably benign 0.01
IGL02041:Olfr804 APN 10 129705235 missense probably damaging 1.00
IGL02245:Olfr804 APN 10 129705739 missense probably damaging 1.00
IGL02341:Olfr804 APN 10 129705489 missense probably damaging 0.99
IGL02433:Olfr804 APN 10 129705576 missense probably benign 0.01
authen UTSW 10 129705799 missense probably benign 0.00
R0111:Olfr804 UTSW 10 129705277 missense probably damaging 1.00
R0309:Olfr804 UTSW 10 129705139 missense probably benign 0.38
R0326:Olfr804 UTSW 10 129705769 missense possibly damaging 0.69
R0374:Olfr804 UTSW 10 129705647 missense probably benign 0.00
R1573:Olfr804 UTSW 10 129705618 missense probably damaging 1.00
R1663:Olfr804 UTSW 10 129705291 missense probably benign 0.44
R1778:Olfr804 UTSW 10 129705705 missense probably benign 0.01
R1789:Olfr804 UTSW 10 129705607 missense possibly damaging 0.82
R1906:Olfr804 UTSW 10 129705496 missense probably benign 0.00
R2108:Olfr804 UTSW 10 129705621 missense probably benign
R2211:Olfr804 UTSW 10 129705451 missense probably benign
R2432:Olfr804 UTSW 10 129704925 missense possibly damaging 0.91
R2902:Olfr804 UTSW 10 129705451 missense probably benign
R5149:Olfr804 UTSW 10 129705508 missense probably benign 0.00
R5153:Olfr804 UTSW 10 129705157 missense probably benign 0.05
R5846:Olfr804 UTSW 10 129704887 missense probably damaging 0.99
R6553:Olfr804 UTSW 10 129705063 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCACTTCCCACATGATTGTTG -3'
(R):5'- TGAAGAGTGCAAGCTTTCATGG -3'

Sequencing Primer
(F):5'- CCACATGATTGTTGTCTCCATAAC -3'
(R):5'- TTCATGGGAAAGTAGAGTATAAGGTG -3'
Posted On2015-05-14