Incidental Mutation 'R0389:Hspg2'
ID31458
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Nameperlecan (heparan sulfate proteoglycan 2)
SynonymsPlc, Pcn, per
MMRRC Submission 038595-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0389 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137468769-137570630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137515423 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 650 (T650A)
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
Predicted Effect probably benign
Transcript: ENSMUST00000030547
AA Change: T650A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: T650A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171332
AA Change: T650A

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: T650A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,671,404 E30K unknown Het
Abi3bp A T 16: 56,671,307 T1319S possibly damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Adgre1 G A 17: 57,406,839 D175N possibly damaging Het
Adgrf1 T C 17: 43,303,788 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Anks1 A G 17: 27,995,952 R458G possibly damaging Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1g C T 11: 94,459,697 V441M probably damaging Het
Cadps2 A T 6: 23,321,782 V1037E possibly damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cenpq T C 17: 40,933,194 probably benign Het
Chrac1 T C 15: 73,093,527 I93T possibly damaging Het
Cntnap2 T A 6: 46,009,637 S359T probably benign Het
Col6a6 C A 9: 105,784,204 M235I probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Cyp1a2 T C 9: 57,682,025 N169D probably benign Het
Dennd1c T A 17: 57,067,649 T499S probably benign Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Eif3h C A 15: 51,799,264 V129F probably damaging Het
Eno2 A G 6: 124,762,691 F380L probably damaging Het
Ergic2 T A 6: 148,183,202 I34F probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam185a C T 5: 21,459,285 T339M probably damaging Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Fam71f2 T A 6: 29,281,392 V43E possibly damaging Het
Fasn G T 11: 120,816,182 D881E probably damaging Het
Fat1 C A 8: 44,950,348 H45Q probably benign Het
Fbxw16 A T 9: 109,432,482 C439S probably benign Het
Gba2 A T 4: 43,570,832 F280Y probably damaging Het
Gfm1 A G 3: 67,457,918 I517V probably benign Het
Gng13 C T 17: 25,718,722 Q8* probably null Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gphn A T 12: 78,590,659 I381F probably damaging Het
Grm3 T C 5: 9,504,794 N833D probably damaging Het
Gstt2 G T 10: 75,832,432 T163K probably damaging Het
Gusb A T 5: 129,998,086 V388E probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Ints2 C T 11: 86,248,851 V306I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Klhl18 A T 9: 110,428,681 C564S probably benign Het
Krt40 T A 11: 99,541,714 R159* probably null Het
L3mbtl4 G A 17: 68,455,780 V103M probably damaging Het
Lnx2 C A 5: 147,019,040 V649L possibly damaging Het
Lpp A T 16: 24,608,241 Q39H probably damaging Het
Lrpprc A T 17: 84,753,112 probably null Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Mbtps2 G T X: 157,568,368 T134K probably benign Het
Mfng C T 15: 78,764,437 V147M possibly damaging Het
Mks1 T C 11: 87,857,928 S273P probably benign Het
Myh2 T C 11: 67,180,821 L488P probably damaging Het
Myo15 A G 11: 60,478,538 N708S probably benign Het
Myo6 A T 9: 80,292,466 N1019I probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Ncoa1 T G 12: 4,295,976 N457T probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nlrp4e C A 7: 23,355,203 N927K probably damaging Het
Npffr2 T C 5: 89,582,754 M181T probably benign Het
Nxf7 A T X: 135,584,383 C495S possibly damaging Het
Oas1g T C 5: 120,887,529 T12A probably benign Het
Olfr130 C G 17: 38,067,671 R167G possibly damaging Het
Olfr23 T A 11: 73,941,053 V269E probably benign Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Olfr591 A T 7: 103,173,283 V118E possibly damaging Het
Olfr744 T A 14: 50,618,579 L119Q probably damaging Het
Papln C T 12: 83,783,379 Q1008* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Phf2 T A 13: 48,804,489 E1016D unknown Het
Phf8 T A X: 151,552,622 D197E probably benign Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Prpf4 A G 4: 62,422,605 Y419C probably damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Prr5 T A 15: 84,702,951 S301T probably benign Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Radil A G 5: 142,543,471 F186L probably damaging Het
Reg3g A T 6: 78,468,561 M1K probably null Het
Rps6ka3 A G X: 159,317,967 Y76C probably damaging Het
Rtl1 C T 12: 109,590,363 V1681I possibly damaging Het
Sfmbt1 C T 14: 30,811,507 R614C probably damaging Het
Slc12a4 A G 8: 105,951,967 S244P probably benign Het
Sptbn1 T C 11: 30,139,250 T671A possibly damaging Het
Supt16 A T 14: 52,174,113 N604K probably damaging Het
Synj2 G A 17: 6,029,783 V1096I probably benign Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tbc1d25 T C X: 8,172,869 Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 D709G probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tgfbi C A 13: 56,629,702 T333N probably benign Het
Tnk1 T C 11: 69,855,682 Y235C probably damaging Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Unc13a A G 8: 71,658,032 F464L probably benign Het
Usp17le C A 7: 104,768,460 A492S probably damaging Het
Vmn1r213 A T 13: 23,011,762 M172L probably benign Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r19 A T 6: 123,335,986 I672F possibly damaging Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Xdh T A 17: 73,898,362 H1036L probably damaging Het
Zfp930 T A 8: 69,228,296 Y214* probably null Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137528820 missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137539195 missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137562201 missense probably benign 0.15
IGL00970:Hspg2 APN 4 137542590 missense probably benign 0.09
IGL01011:Hspg2 APN 4 137559335 missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137546658 missense probably benign 0.11
IGL01333:Hspg2 APN 4 137540314 missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137538489 missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137553817 missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137519706 missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137539183 missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137552803 missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137514773 missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137564926 missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137512671 missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137561926 missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137540073 missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137552254 missense probably benign
IGL02051:Hspg2 APN 4 137568389 unclassified probably benign
IGL02124:Hspg2 APN 4 137518814 splice site probably null
IGL02128:Hspg2 APN 4 137564016 missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137515316 missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137518645 missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137510577 missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137508389 missense probably benign 0.03
IGL02477:Hspg2 APN 4 137544512 splice site probably benign
IGL02514:Hspg2 APN 4 137569576 missense probably benign 0.09
IGL02613:Hspg2 APN 4 137544420 missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137512642 missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137551848 missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137557445 splice site probably benign
IGL02701:Hspg2 APN 4 137557174 missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137555130 missense probably benign 0.00
IGL02985:Hspg2 APN 4 137507803 missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137561825 critical splice donor site probably null
IGL03181:Hspg2 APN 4 137515937 missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137560522 splice site probably benign
PIT4305001:Hspg2 UTSW 4 137550373 missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137519931 missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137542849 missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137562201 missense probably benign 0.15
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137511158 missense probably damaging 1.00
R0468:Hspg2 UTSW 4 137533529 missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137550024 missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137502294 missense probably benign
R0599:Hspg2 UTSW 4 137512401 missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137553280 missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137512349 missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137541440 missense probably benign 0.00
R1403:Hspg2 UTSW 4 137540100 missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137517636 missense probably benign
R1497:Hspg2 UTSW 4 137548096 missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137511241 splice site probably benign
R1625:Hspg2 UTSW 4 137518971 missense probably benign 0.23
R1630:Hspg2 UTSW 4 137518435 missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137533437 nonsense probably null
R1699:Hspg2 UTSW 4 137548012 splice site probably null
R1703:Hspg2 UTSW 4 137559151 missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137514673 missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137520156 missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137518509 missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137545567 missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137565490 missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137542552 missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137564895 missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137568366 missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137559367 missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137520109 missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137517604 missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137522043 missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137549574 missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137555290 missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137565504 splice site probably benign
R3873:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137559314 missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137556657 missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137468911 missense probably benign 0.17
R4355:Hspg2 UTSW 4 137529418 missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4411:Hspg2 UTSW 4 137562224 missense probably benign
R4421:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4592:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137539575 missense possibly damaging 0.80
R4619:Hspg2 UTSW 4 137546573 missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137533730 missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137539645 missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137522127 missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137570073 unclassified probably benign
R4793:Hspg2 UTSW 4 137529473 missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137565395 missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137541666 missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137542530 missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137508031 missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137511926 missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137543914 missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137528794 splice site probably null
R5529:Hspg2 UTSW 4 137551828 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137520551 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137542825 missense probably benign 0.17
R5546:Hspg2 UTSW 4 137548174 critical splice donor site probably null
R5728:Hspg2 UTSW 4 137542766 missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137561721 missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137553782 missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137540735 missense probably benign
R6164:Hspg2 UTSW 4 137514655 missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137569518 missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137540248 missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137519686 missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137544705 missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137561955 missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137541695 missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137539396 missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137507801 missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137555275 missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137565737 missense probably benign 0.18
R6724:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137551803 missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137508398 missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137540720 missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137519289 missense probably benign 0.45
R6968:Hspg2 UTSW 4 137535156 missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137528890 missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137542269 missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137544366 missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137510652 missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137552116 missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137514719 missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137533561 critical splice donor site probably null
R7238:Hspg2 UTSW 4 137508393 missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137519946 missense probably benign 0.15
R7278:Hspg2 UTSW 4 137551125 missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137529556 missense probably benign 0.00
R7390:Hspg2 UTSW 4 137539179 missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137515664 missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137539403 missense probably benign 0.17
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137550391 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCCTGTGCCCACTTCTCTATAAG -3'
(R):5'- TGTCCATGACAATGTCACTCAGCC -3'

Sequencing Primer
(F):5'- CTGTGGGCAGACTAAGGACC -3'
(R):5'- ACTGTCTGTAGCAGGACAGC -3'
Posted On2013-04-24