Incidental Mutation 'R4115:Nrcam'
ID314602
Institutional Source Beutler Lab
Gene Symbol Nrcam
Ensembl Gene ENSMUSG00000020598
Gene Nameneuronal cell adhesion molecule
SynonymsC030017F07Rik, Bravo, C130076O07Rik
MMRRC Submission 041630-MU
Accession Numbers

Genbank: NM_176930.4, NM_001146031.1,

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4115 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location44328885-44601964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44566326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 606 (V606A)
Ref Sequence ENSEMBL: ENSMUSP00000151844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748] [ENSMUST00000220123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020939
AA Change: V600A

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598
AA Change: V600A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
low complexity region 618 623 N/A INTRINSIC
FN3 641 724 3.24e-10 SMART
FN3 738 824 1.77e-2 SMART
FN3 840 931 1.97e-9 SMART
FN3 946 1031 3.73e-10 SMART
transmembrane domain 1120 1142 N/A INTRINSIC
Pfam:Bravo_FIGEY 1143 1232 2.9e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110748
AA Change: V600A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598
AA Change: V600A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
FN3 631 714 3.24e-10 SMART
FN3 728 814 1.77e-2 SMART
FN3 830 921 1.97e-9 SMART
FN3 936 1021 3.73e-10 SMART
transmembrane domain 1050 1072 N/A INTRINSIC
Pfam:Bravo_FIGEY 1073 1164 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219906
Predicted Effect possibly damaging
Transcript: ENSMUST00000220123
AA Change: V606A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220130
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
BC005561 T C 5: 104,519,433 L607S probably damaging Het
BC035044 C T 6: 128,890,850 probably benign Het
Camta2 T C 11: 70,676,474 M626V possibly damaging Het
Cdh7 G A 1: 110,138,309 R771Q probably benign Het
Chd3 T G 11: 69,357,517 I850L possibly damaging Het
Cspg4 T A 9: 56,898,394 L2163Q probably damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Dcun1d3 T C 7: 119,859,734 N26S probably benign Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gnl3 T G 14: 31,016,856 K79Q probably damaging Het
Hat1 A G 2: 71,441,222 T380A probably benign Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Ighv11-1 A G 12: 113,982,065 V56A probably benign Het
Ism2 A G 12: 87,287,031 I80T probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kif1a T A 1: 93,052,538 E823V probably damaging Het
Letm2 T A 8: 25,580,327 K432* probably null Het
Mc4r T A 18: 66,859,979 Y21F probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mycbpap C A 11: 94,512,225 probably null Het
Nfkbil1 A G 17: 35,221,310 M129T probably damaging Het
Notch3 C A 17: 32,158,433 C223F probably damaging Het
Nudcd2 T C 11: 40,736,607 M118T probably damaging Het
Olfr341 A T 2: 36,479,785 L115Q probably damaging Het
Oraov1 G A 7: 144,919,646 V142M possibly damaging Het
Pcsk5 C T 19: 17,433,419 D1870N unknown Het
Pde3b T C 7: 114,521,727 F696L probably damaging Het
Pde8a T A 7: 81,282,807 probably null Het
Pgm2 C T 4: 99,962,151 Q191* probably null Het
Psg20 A G 7: 18,685,980 S5P probably damaging Het
Reps1 C T 10: 18,104,207 P397S possibly damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Spata13 G T 14: 60,692,478 G168V probably damaging Het
Spta1 T C 1: 174,240,357 W2117R probably damaging Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trpm6 T C 19: 18,832,557 W1106R probably damaging Het
Tssk3 T C 4: 129,489,507 Y124C probably damaging Het
Ugt2b1 A G 5: 86,926,414 W29R probably damaging Het
Vmn2r97 T C 17: 18,928,070 F76L probably benign Het
Other mutations in Nrcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Nrcam APN 12 44575884 missense probably benign 0.27
IGL01657:Nrcam APN 12 44559800 missense probably damaging 1.00
IGL02434:Nrcam APN 12 44590243 splice site probably benign
IGL02455:Nrcam APN 12 44570530 missense probably damaging 1.00
IGL02712:Nrcam APN 12 44573827 missense probably damaging 1.00
IGL02834:Nrcam APN 12 44541075 critical splice donor site probably null
IGL03022:Nrcam APN 12 44598442 missense probably damaging 1.00
IGL03174:Nrcam APN 12 44576006 splice site probably benign
IGL03389:Nrcam APN 12 44549906 missense probably benign 0.00
IGL03397:Nrcam APN 12 44559757 missense probably damaging 1.00
I2288:Nrcam UTSW 12 44564315 missense probably benign 0.06
I2289:Nrcam UTSW 12 44564315 missense probably benign 0.06
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0195:Nrcam UTSW 12 44584845 missense probably benign 0.00
R0463:Nrcam UTSW 12 44551341 missense probably damaging 1.00
R0590:Nrcam UTSW 12 44564032 missense probably damaging 1.00
R0674:Nrcam UTSW 12 44564322 missense probably benign 0.17
R0930:Nrcam UTSW 12 44549884 missense probably benign
R1241:Nrcam UTSW 12 44590164 missense probably damaging 1.00
R1279:Nrcam UTSW 12 44544877 unclassified probably null
R1523:Nrcam UTSW 12 44572249 missense probably damaging 1.00
R1572:Nrcam UTSW 12 44537364 splice site probably benign
R1629:Nrcam UTSW 12 44563986 missense probably benign 0.00
R1651:Nrcam UTSW 12 44576679 missense probably damaging 0.97
R1729:Nrcam UTSW 12 44573850 missense probably benign
R1739:Nrcam UTSW 12 44571675 missense probably damaging 1.00
R1803:Nrcam UTSW 12 44572208 missense probably benign
R1884:Nrcam UTSW 12 44544755 missense probably damaging 1.00
R1974:Nrcam UTSW 12 44563993 missense probably benign 0.05
R1992:Nrcam UTSW 12 44540970 missense probably damaging 1.00
R2102:Nrcam UTSW 12 44576688 missense probably benign 0.00
R2106:Nrcam UTSW 12 44570290 missense probably benign 0.12
R3854:Nrcam UTSW 12 44575884 missense probably benign 0.27
R4005:Nrcam UTSW 12 44532646 missense probably benign
R4088:Nrcam UTSW 12 44572202 missense possibly damaging 0.93
R4428:Nrcam UTSW 12 44576775 missense possibly damaging 0.95
R4458:Nrcam UTSW 12 44559730 missense probably damaging 1.00
R4580:Nrcam UTSW 12 44562540 critical splice donor site probably null
R4601:Nrcam UTSW 12 44591056 missense probably damaging 1.00
R4688:Nrcam UTSW 12 44547237 missense probably benign
R4825:Nrcam UTSW 12 44575986 nonsense probably null
R4838:Nrcam UTSW 12 44574019 missense probably damaging 1.00
R4950:Nrcam UTSW 12 44598490 missense probably damaging 1.00
R4960:Nrcam UTSW 12 44566299 missense probably benign 0.01
R5081:Nrcam UTSW 12 44570353 missense probably benign 0.00
R5297:Nrcam UTSW 12 44544784 missense probably damaging 1.00
R5504:Nrcam UTSW 12 44564132 critical splice donor site probably null
R5593:Nrcam UTSW 12 44559700 missense probably damaging 1.00
R5654:Nrcam UTSW 12 44564058 missense probably benign
R5691:Nrcam UTSW 12 44564256 missense probably damaging 1.00
R5890:Nrcam UTSW 12 44576771 missense probably benign
R5937:Nrcam UTSW 12 44572291 missense probably benign 0.00
R5980:Nrcam UTSW 12 44571633 missense probably damaging 1.00
R6132:Nrcam UTSW 12 44570224 missense probably damaging 1.00
R6213:Nrcam UTSW 12 44562432 missense possibly damaging 0.90
R6334:Nrcam UTSW 12 44572300 missense probably benign
R6617:Nrcam UTSW 12 44540963 missense probably damaging 1.00
R6666:Nrcam UTSW 12 44571555 missense probably damaging 1.00
R7191:Nrcam UTSW 12 44572244 missense probably benign 0.01
R7284:Nrcam UTSW 12 44564034 missense probably damaging 1.00
R7326:Nrcam UTSW 12 44564026 missense possibly damaging 0.95
R7388:Nrcam UTSW 12 44598489 missense probably damaging 1.00
U24488:Nrcam UTSW 12 44537259 missense probably damaging 1.00
X0057:Nrcam UTSW 12 44551416 missense probably benign
X0066:Nrcam UTSW 12 44550029 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTGACAATAGGGGTTCACTCC -3'
(R):5'- CTCTGGGAGAAGAAAACCACTC -3'

Sequencing Primer
(F):5'- AATAGGGGTTCACTCCTATTGC -3'
(R):5'- TGGGAGAAGAAAACCACTCATCCTTG -3'
Posted On2015-05-14