Incidental Mutation 'R4115:Vmn2r97'
ID314611
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Namevomeronasal 2, receptor 97
SynonymsEG627367
MMRRC Submission 041630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4115 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18914300-18958087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18928070 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 76 (F76L)
Ref Sequence ENSEMBL: ENSMUSP00000156141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
Predicted Effect probably benign
Transcript: ENSMUST00000168710
AA Change: F76L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: F76L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232219
AA Change: F76L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232325
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
BC005561 T C 5: 104,519,433 L607S probably damaging Het
BC035044 C T 6: 128,890,850 probably benign Het
Camta2 T C 11: 70,676,474 M626V possibly damaging Het
Cdh7 G A 1: 110,138,309 R771Q probably benign Het
Chd3 T G 11: 69,357,517 I850L possibly damaging Het
Cspg4 T A 9: 56,898,394 L2163Q probably damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Dcun1d3 T C 7: 119,859,734 N26S probably benign Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gnl3 T G 14: 31,016,856 K79Q probably damaging Het
Hat1 A G 2: 71,441,222 T380A probably benign Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Ighv11-1 A G 12: 113,982,065 V56A probably benign Het
Ism2 A G 12: 87,287,031 I80T probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kif1a T A 1: 93,052,538 E823V probably damaging Het
Letm2 T A 8: 25,580,327 K432* probably null Het
Mc4r T A 18: 66,859,979 Y21F probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mycbpap C A 11: 94,512,225 probably null Het
Nfkbil1 A G 17: 35,221,310 M129T probably damaging Het
Notch3 C A 17: 32,158,433 C223F probably damaging Het
Nrcam T C 12: 44,566,326 V606A possibly damaging Het
Nudcd2 T C 11: 40,736,607 M118T probably damaging Het
Olfr341 A T 2: 36,479,785 L115Q probably damaging Het
Oraov1 G A 7: 144,919,646 V142M possibly damaging Het
Pcsk5 C T 19: 17,433,419 D1870N unknown Het
Pde3b T C 7: 114,521,727 F696L probably damaging Het
Pde8a T A 7: 81,282,807 probably null Het
Pgm2 C T 4: 99,962,151 Q191* probably null Het
Psg20 A G 7: 18,685,980 S5P probably damaging Het
Reps1 C T 10: 18,104,207 P397S possibly damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Spata13 G T 14: 60,692,478 G168V probably damaging Het
Spta1 T C 1: 174,240,357 W2117R probably damaging Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trpm6 T C 19: 18,832,557 W1106R probably damaging Het
Tssk3 T C 4: 129,489,507 Y124C probably damaging Het
Ugt2b1 A G 5: 86,926,414 W29R probably damaging Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
PIT4469001:Vmn2r97 UTSW 17 18929616 missense probably benign 0.00
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7044:Vmn2r97 UTSW 17 18914367 missense probably benign 0.05
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
R7503:Vmn2r97 UTSW 17 18928208 missense not run
Predicted Primers PCR Primer
(F):5'- GGTAAAGGAGCCTGCTTAAACC -3'
(R):5'- GTGAGTGCAGCTGTGAAATTTC -3'

Sequencing Primer
(F):5'- AGGAGCCTGCTTAAACCTAATG -3'
(R):5'- GGTATATAATTTCCGTCACCAAGAGC -3'
Posted On2015-05-14