Incidental Mutation 'R4116:Polr3c'
ID314623
Institutional Source Beutler Lab
Gene Symbol Polr3c
Ensembl Gene ENSMUSG00000028099
Gene Namepolymerase (RNA) III (DNA directed) polypeptide C
Synonyms4933407E01Rik, RPC62, RPC3
MMRRC Submission 040859-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4116 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96711490-96727628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96715244 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 365 (F365Y)
Ref Sequence ENSEMBL: ENSMUSP00000122435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029741] [ENSMUST00000154679]
Predicted Effect probably damaging
Transcript: ENSMUST00000029741
AA Change: F365Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029741
Gene: ENSMUSG00000028099
AA Change: F365Y

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 9.4e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128918
SMART Domains Protein: ENSMUSP00000119236
Gene: ENSMUSG00000028099

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc82 20 180 5.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137009
Predicted Effect probably damaging
Transcript: ENSMUST00000154679
AA Change: F365Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122435
Gene: ENSMUSG00000028099
AA Change: F365Y

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 1.6e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,891 F395L possibly damaging Het
Amigo1 C T 3: 108,188,445 T420I probably damaging Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Cald1 C T 6: 34,745,719 R107C probably damaging Het
Cast C T 13: 74,724,837 E444K probably damaging Het
Crybg1 T G 10: 43,999,162 N650T possibly damaging Het
Cyp19a1 T A 9: 54,168,741 R276S possibly damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Gm6588 A G 5: 112,450,511 E308G probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Hoxd13 C A 2: 74,668,488 A60E possibly damaging Het
Igkv3-7 G T 6: 70,607,939 G88C probably damaging Het
Kcnk12 GGCATCGC GGCATCGCATCGC 17: 87,746,156 probably null Het
Klhl30 C A 1: 91,354,108 Q144K probably benign Het
Kprp A T 3: 92,823,968 S592T probably damaging Het
Man2c1 T C 9: 57,140,305 probably null Het
Mbtps1 A T 8: 119,541,652 M260K probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Mtcl1 T C 17: 66,366,481 T767A probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nomo1 T C 7: 46,033,896 I22T probably benign Het
Olfr845 T G 9: 19,338,644 F61L probably benign Het
Plin4 A G 17: 56,102,113 V1369A probably benign Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sema4f G A 6: 82,917,906 T436M probably benign Het
Sf3a2 A G 10: 80,801,341 T37A probably damaging Het
Slc1a6 A G 10: 78,787,889 M41V probably benign Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Sspo T C 6: 48,456,994 L911P probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Syne2 A T 12: 75,931,079 I1433F probably damaging Het
Synm C T 7: 67,734,657 V644I possibly damaging Het
Tbc1d5 A G 17: 50,920,587 L210P probably damaging Het
Trak1 T C 9: 121,448,843 Y229H probably damaging Het
Unc5b G T 10: 60,774,700 T446K probably damaging Het
Wdr95 C A 5: 149,597,575 D604E probably benign Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Polr3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Polr3c APN 3 96713520 missense probably damaging 1.00
IGL01904:Polr3c APN 3 96716665 critical splice donor site probably null
IGL01964:Polr3c APN 3 96711975 unclassified probably benign
IGL02640:Polr3c APN 3 96716686 missense probably damaging 0.98
IGL02955:Polr3c APN 3 96714312 missense probably damaging 1.00
IGL03129:Polr3c APN 3 96719454 splice site probably benign
IGL03263:Polr3c APN 3 96714251 splice site probably benign
R0503:Polr3c UTSW 3 96713636 splice site probably null
R0800:Polr3c UTSW 3 96719311 missense probably damaging 0.99
R0881:Polr3c UTSW 3 96723847 missense probably damaging 0.99
R1763:Polr3c UTSW 3 96713595 missense probably damaging 1.00
R1931:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1932:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1994:Polr3c UTSW 3 96714373 splice site probably null
R3771:Polr3c UTSW 3 96725854 missense probably damaging 1.00
R4614:Polr3c UTSW 3 96716471 missense probably benign 0.00
R4732:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R4733:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R5057:Polr3c UTSW 3 96712057 missense probably damaging 0.98
R5058:Polr3c UTSW 3 96723517 missense probably benign 0.01
R5756:Polr3c UTSW 3 96714134 missense probably damaging 1.00
R6005:Polr3c UTSW 3 96719468 missense possibly damaging 0.96
R6009:Polr3c UTSW 3 96713614 missense probably damaging 1.00
R6580:Polr3c UTSW 3 96727343 splice site probably null
R7003:Polr3c UTSW 3 96723638 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTGATTTCTTGGTGCACCC -3'
(R):5'- AGAGGAACAGTGCCATCACC -3'

Sequencing Primer
(F):5'- CTCTCTGAGAGGCCAGTTAAAGTC -3'
(R):5'- CAACCTCAGGAGCTGTGTCAG -3'
Posted On2015-05-14