Mutagenetix > Incidental Mutation

Incidental Mutation 'R4116:Sptbn4'

314634

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4

MMRRC Submission

040859-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.379) question?

Stock #

R4116 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27055808-27147111 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 27090995 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1399 (E1399K)

Ref Sequence

ENSEMBL: ENSMUSP00000132807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably damaging
Transcript: ENSMUST00000011895
AA Change: E1404K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: E1404K

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108362
AA Change: E84K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: E84K

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108363
AA Change: E84K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: E84K

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108364
AA Change: E84K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: E84K

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172269
AA Change: E1399K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: E1399K

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,634,817 (GRCm39)	F395L	possibly damaging	Het
Amigo1	C	T	3: 108,095,761 (GRCm39)	T420I	probably damaging	Het
Ankrd34c	A	G	9: 89,611,927 (GRCm39)	L138P	probably damaging	Het
Cald1	C	T	6: 34,722,654 (GRCm39)	R107C	probably damaging	Het
Cast	C	T	13: 74,872,956 (GRCm39)	E444K	probably damaging	Het
Ccdc121rt2	A	G	5: 112,598,377 (GRCm39)	E308G	probably damaging	Het
Crybg1	T	G	10: 43,875,158 (GRCm39)	N650T	possibly damaging	Het
Cyp19a1	T	A	9: 54,076,025 (GRCm39)	R276S	possibly damaging	Het
Cyp2c66	A	G	19: 39,165,003 (GRCm39)	D328G	possibly damaging	Het
Hectd1	A	T	12: 51,815,506 (GRCm39)	L1527*	probably null	Het
Hoxd13	C	A	2: 74,498,832 (GRCm39)	A60E	possibly damaging	Het
Igkv3-7	G	T	6: 70,584,923 (GRCm39)	G88C	probably damaging	Het
Kcnk12	GGCATCGC	GGCATCGCATCGC	17: 88,053,584 (GRCm39)		probably null	Het
Klhl30	C	A	1: 91,281,830 (GRCm39)	Q144K	probably benign	Het
Kprp	A	T	3: 92,731,275 (GRCm39)	S592T	probably damaging	Het
Man2c1	T	C	9: 57,047,589 (GRCm39)		probably null	Het
Mbtps1	A	T	8: 120,268,391 (GRCm39)	M260K	probably benign	Het
Morc3	G	A	16: 93,670,227 (GRCm39)	D801N	probably benign	Het
Mpped1	A	G	15: 83,680,910 (GRCm39)		probably benign	Het
Mtcl1	T	C	17: 66,673,476 (GRCm39)	T767A	probably benign	Het
Nek5	G	A	8: 22,601,178 (GRCm39)	T181M	probably damaging	Het
Nomo1	T	C	7: 45,683,320 (GRCm39)	I22T	probably benign	Het
Or7g27	T	G	9: 19,249,940 (GRCm39)	F61L	probably benign	Het
Plin4	A	G	17: 56,409,113 (GRCm39)	V1369A	probably benign	Het
Polr3c	A	T	3: 96,622,560 (GRCm39)	F365Y	probably damaging	Het
Sec22a	A	G	16: 35,139,202 (GRCm39)	F232S	probably damaging	Het
Sema4f	G	A	6: 82,894,887 (GRCm39)	T436M	probably benign	Het
Sf3a2	A	G	10: 80,637,175 (GRCm39)	T37A	probably damaging	Het
Slc1a6	A	G	10: 78,623,723 (GRCm39)	M41V	probably benign	Het
Sspo	T	C	6: 48,433,928 (GRCm39)	L911P	probably damaging	Het
Sult2a2	A	T	7: 13,468,708 (GRCm39)	Q58L	probably benign	Het
Syne2	A	T	12: 75,977,853 (GRCm39)	I1433F	probably damaging	Het
Synm	C	T	7: 67,384,405 (GRCm39)	V644I	possibly damaging	Het
Tbc1d5	A	G	17: 51,227,615 (GRCm39)	L210P	probably damaging	Het
Trak1	T	C	9: 121,277,909 (GRCm39)	Y229H	probably damaging	Het
Unc5b	G	T	10: 60,610,479 (GRCm39)	T446K	probably damaging	Het
Wdr95	C	A	5: 149,521,040 (GRCm39)	D604E	probably benign	Het
Zfp773	AGCTGCTGCTGCTGCTGCTGCTGCTGC	AGCTGCTGCTGCTGCTGCTGCTGC	7: 7,136,092 (GRCm39)		probably benign	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27,068,859 (GRCm39)	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27,117,390 (GRCm39)	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27,114,196 (GRCm39)	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27,103,693 (GRCm39)	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27,063,571 (GRCm39)	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27,063,940 (GRCm39)	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27,063,782 (GRCm39)	missense	probably benign
IGL02226:Sptbn4	APN	7	27,065,132 (GRCm39)	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27,063,724 (GRCm39)	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27,127,672 (GRCm39)	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27,065,014 (GRCm39)	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27,118,522 (GRCm39)	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27,090,976 (GRCm39)	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27,067,104 (GRCm39)	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27,126,258 (GRCm39)	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27,126,258 (GRCm39)	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27,093,573 (GRCm39)	splice site	probably benign
IGL02961:Sptbn4	APN	7	27,097,392 (GRCm39)	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27,056,812 (GRCm39)	nonsense	probably null
R0194:Sptbn4	UTSW	7	27,104,336 (GRCm39)	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27,059,161 (GRCm39)	splice site	probably benign
R0510:Sptbn4	UTSW	7	27,060,991 (GRCm39)	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27,063,803 (GRCm39)	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27,107,753 (GRCm39)	nonsense	probably null
R1336:Sptbn4	UTSW	7	27,117,388 (GRCm39)	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27,133,719 (GRCm39)	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27,118,164 (GRCm39)	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27,118,008 (GRCm39)	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27,066,071 (GRCm39)	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27,090,856 (GRCm39)	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27,106,563 (GRCm39)	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27,065,868 (GRCm39)	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27,067,127 (GRCm39)	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27,123,235 (GRCm39)	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27,065,844 (GRCm39)	nonsense	probably null
R2083:Sptbn4	UTSW	7	27,127,681 (GRCm39)	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27,063,587 (GRCm39)	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27,067,034 (GRCm39)	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27,133,782 (GRCm39)	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27,133,782 (GRCm39)	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27,059,517 (GRCm39)	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27,117,523 (GRCm39)	nonsense	probably null
R4115:Sptbn4	UTSW	7	27,090,995 (GRCm39)	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27,117,896 (GRCm39)	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27,123,223 (GRCm39)	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27,067,127 (GRCm39)	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27,066,160 (GRCm39)	missense	possibly damaging	0.60
R4684:Sptbn4	UTSW	7	27,063,844 (GRCm39)	missense	probably damaging	0.96
R4707:Sptbn4	UTSW	7	27,116,431 (GRCm39)	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27,071,577 (GRCm39)	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27,068,816 (GRCm39)	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27,059,166 (GRCm39)	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27,065,853 (GRCm39)	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27,118,138 (GRCm39)	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27,103,678 (GRCm39)	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27,071,596 (GRCm39)	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27,118,024 (GRCm39)	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27,063,904 (GRCm39)	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27,059,513 (GRCm39)	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27,064,012 (GRCm39)	nonsense	probably null
R6762:Sptbn4	UTSW	7	27,093,633 (GRCm39)	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27,071,375 (GRCm39)	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27,117,481 (GRCm39)	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27,116,210 (GRCm39)	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27,066,114 (GRCm39)	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27,108,439 (GRCm39)	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27,127,693 (GRCm39)	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27,075,015 (GRCm39)	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27,141,960 (GRCm39)	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27,071,697 (GRCm39)	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27,061,002 (GRCm39)	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27,063,761 (GRCm39)	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27,061,059 (GRCm39)	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27,061,835 (GRCm39)	missense	probably benign
R8002:Sptbn4	UTSW	7	27,117,417 (GRCm39)	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27,063,694 (GRCm39)	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27,074,808 (GRCm39)	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27,108,314 (GRCm39)	nonsense	probably null
R8353:Sptbn4	UTSW	7	27,103,663 (GRCm39)	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27,071,721 (GRCm39)	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27,103,663 (GRCm39)	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27,106,657 (GRCm39)	nonsense	probably null
R8818:Sptbn4	UTSW	7	27,063,592 (GRCm39)	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27,141,844 (GRCm39)	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27,067,124 (GRCm39)	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27,132,624 (GRCm39)	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27,117,504 (GRCm39)	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27,066,095 (GRCm39)	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27,107,807 (GRCm39)	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27,091,000 (GRCm39)	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27,107,993 (GRCm39)	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27,071,662 (GRCm39)	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27,071,662 (GRCm39)	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27,056,717 (GRCm39)	makesense	probably null
X0020:Sptbn4	UTSW	7	27,102,159 (GRCm39)	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27,056,736 (GRCm39)	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27,059,450 (GRCm39)	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27,108,527 (GRCm39)	missense	probably benign	0.41
Z1177:Sptbn4	UTSW	7	27,104,007 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGTTGAAACACCCCAGAG -3'
(R):5'- TTGTCACGGAATCTCTGTCTG -3'

Sequencing Primer
(F):5'- CAGAGGGTTGGATGTGAGCCC -3'
(R):5'- ACGGAATCTCTGTCTGTTTCTG -3'

Posted On

2015-05-14