Incidental Mutation 'R4116:Slc1a6'
ID314646
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
MMRRC Submission 040859-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4116 (G1)
Quality Score220
Status Not validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78787889 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 41 (M41V)
Ref Sequence ENSEMBL: ENSMUSP00000151544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490] [ENSMUST00000217717]
Predicted Effect probably benign
Transcript: ENSMUST00000005490
AA Change: M41V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: M41V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217717
AA Change: M41V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,891 F395L possibly damaging Het
Amigo1 C T 3: 108,188,445 T420I probably damaging Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Cald1 C T 6: 34,745,719 R107C probably damaging Het
Cast C T 13: 74,724,837 E444K probably damaging Het
Crybg1 T G 10: 43,999,162 N650T possibly damaging Het
Cyp19a1 T A 9: 54,168,741 R276S possibly damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Gm6588 A G 5: 112,450,511 E308G probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Hoxd13 C A 2: 74,668,488 A60E possibly damaging Het
Igkv3-7 G T 6: 70,607,939 G88C probably damaging Het
Kcnk12 GGCATCGC GGCATCGCATCGC 17: 87,746,156 probably null Het
Klhl30 C A 1: 91,354,108 Q144K probably benign Het
Kprp A T 3: 92,823,968 S592T probably damaging Het
Man2c1 T C 9: 57,140,305 probably null Het
Mbtps1 A T 8: 119,541,652 M260K probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Mtcl1 T C 17: 66,366,481 T767A probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nomo1 T C 7: 46,033,896 I22T probably benign Het
Olfr845 T G 9: 19,338,644 F61L probably benign Het
Plin4 A G 17: 56,102,113 V1369A probably benign Het
Polr3c A T 3: 96,715,244 F365Y probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sema4f G A 6: 82,917,906 T436M probably benign Het
Sf3a2 A G 10: 80,801,341 T37A probably damaging Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Sspo T C 6: 48,456,994 L911P probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Syne2 A T 12: 75,931,079 I1433F probably damaging Het
Synm C T 7: 67,734,657 V644I possibly damaging Het
Tbc1d5 A G 17: 50,920,587 L210P probably damaging Het
Trak1 T C 9: 121,448,843 Y229H probably damaging Het
Unc5b G T 10: 60,774,700 T446K probably damaging Het
Wdr95 C A 5: 149,597,575 D604E probably benign Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
R7166:Slc1a6 UTSW 10 78812812 missense possibly damaging 0.96
R7292:Slc1a6 UTSW 10 78814604 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCTGACTTCTGAGCTGCAATG -3'
(R):5'- ACGTCGTGTTCATACAACTGTG -3'

Sequencing Primer
(F):5'- GACTTCTGAGCTGCAATGTTCATTC -3'
(R):5'- CGTGTTCATACAACTGTGTTTGAC -3'
Posted On2015-05-14