Incidental Mutation 'R4132:Cmtm1'
List |< first << previous [record 89 of 585] next >> last >|
ID314704
Institutional Source Beutler Lab
Gene Symbol Cmtm1
Ensembl Gene ENSMUSG00000110430
Gene NameCKLF-like MARVEL transmembrane domain containing 1
SynonymsCklfsf1, CHLFH1a, CKLFH1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R4132 (G1)
Quality Score146
Status Not validated
Chromosome8
Chromosomal Location104292622-104310145 bp(-) (GRCm38)
Type of Mutationsmall deletion (11 aa in frame mutation)
DNA Base Change (assembly) CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT at 104309470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159039] [ENSMUST00000160596] [ENSMUST00000162616] [ENSMUST00000164175]
Predicted Effect probably benign
Transcript: ENSMUST00000159039
SMART Domains Protein: ENSMUSP00000124855
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 7.45e-12 PROSPERO
internal_repeat_2 34 74 9.92e-7 PROSPERO
internal_repeat_1 66 103 7.45e-12 PROSPERO
internal_repeat_2 122 162 9.92e-7 PROSPERO
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160596
SMART Domains Protein: ENSMUSP00000124656
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162616
SMART Domains Protein: ENSMUSP00000124800
Gene: ENSMUSG00000031876

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164175
SMART Domains Protein: ENSMUSP00000132828
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 34 71 1.23e-5 PROSPERO
internal_repeat_1 100 137 1.23e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212847
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy1 T C 1: 92,885,100 M496V probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Gm1527 A T 3: 28,920,630 I531L probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Icam5 T C 9: 21,036,657 I617T probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhdc4 C T 8: 121,798,065 G375R possibly damaging Het
Myo5c G A 9: 75,252,568 V293I probably benign Het
Ncbp1 C T 4: 46,169,241 R672* probably null Het
Pcdhga2 T C 18: 37,670,054 I317T possibly damaging Het
Safb C A 17: 56,600,848 probably benign Het
Tspan5 C T 3: 138,896,867 R106* probably null Het
Ubap2l A G 3: 90,009,184 Y908H probably damaging Het
Uspl1 A G 5: 149,204,349 N372S probably damaging Het
Vmn1r210 T C 13: 22,827,649 I156V probably benign Het
Zbtb8os A G 4: 129,336,113 Y24C probably damaging Het
Other mutations in Cmtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2900:Cmtm1 UTSW 8 104309544 missense possibly damaging 0.95
R4615:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4723:Cmtm1 UTSW 8 104293675 missense probably damaging 0.96
R5277:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5347:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5364:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5394:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5403:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5611:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5715:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5731:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5773:Cmtm1 UTSW 8 104305176 missense probably damaging 1.00
R6017:Cmtm1 UTSW 8 104310951 unclassified probably benign
R6207:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6313:Cmtm1 UTSW 8 104305163 missense possibly damaging 0.81
R6528:Cmtm1 UTSW 8 104309295 missense possibly damaging 0.90
R6817:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6821:Cmtm1 UTSW 8 104309702
R6822:Cmtm1 UTSW 8 104309702
Predicted Primers PCR Primer
(F):5'- TCAACATCCCATTGGCTGAGC -3'
(R):5'- TATACCATCCAGGCAGCGAC -3'

Sequencing Primer
(F):5'- TGCCAGAAGCTATCTCTGAATC -3'
(R):5'- GGCAGCGACCTTCAGTACAAG -3'
Posted On2015-05-14