Incidental Mutation 'R4133:Tex10'
ID314735
Institutional Source Beutler Lab
Gene Symbol Tex10
Ensembl Gene ENSMUSG00000028345
Gene Nametestis expressed gene 10
Synonymsclone 18330, 2810462N03Rik, 2610206N19Rik
MMRRC Submission 041637-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R4133 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location48430858-48473459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48468968 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 69 (Y69C)
Ref Sequence ENSEMBL: ENSMUSP00000132498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030030] [ENSMUST00000155905] [ENSMUST00000164866]
Predicted Effect probably damaging
Transcript: ENSMUST00000030030
AA Change: Y69C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030030
Gene: ENSMUSG00000028345
AA Change: Y69C

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 130 235 9.7e-24 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155750
Predicted Effect probably benign
Transcript: ENSMUST00000155905
SMART Domains Protein: ENSMUSP00000114669
Gene: ENSMUSG00000028345

DomainStartEndE-ValueType
Pfam:Ipi1_N 47 152 3.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164866
AA Change: Y69C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132498
Gene: ENSMUSG00000028345
AA Change: Y69C

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 132 235 4.1e-25 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E7.5 with impaired inner cell mass proliferation in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,769,998 noncoding transcript Het
Aldh3b1 A G 19: 3,920,808 I184T probably damaging Het
Arhgap42 C T 9: 9,011,299 probably benign Het
Arhgef4 A G 1: 34,806,104 D1463G probably damaging Het
Arpc5 A G 1: 152,768,871 T52A probably benign Het
Asb6 A G 2: 30,828,235 probably benign Het
Ash1l T C 3: 88,982,260 V482A probably benign Het
Bop1 T C 15: 76,454,335 N469S probably benign Het
Btaf1 T A 19: 36,961,738 N266K probably benign Het
Btla T C 16: 45,239,298 Y122H probably damaging Het
Cacna1g A G 11: 94,432,544 M1278T probably damaging Het
Cdc42bpb A G 12: 111,321,542 S524P probably benign Het
Cep78 A G 19: 15,969,155 S438P probably damaging Het
Clca4a T G 3: 144,969,352 E171D probably benign Het
Cldn6 A T 17: 23,681,493 I144F probably damaging Het
Cpd G A 11: 76,814,818 Q363* probably null Het
Cpn1 G A 19: 43,986,284 P2L possibly damaging Het
Ddx31 A G 2: 28,858,852 D264G probably damaging Het
Ddx39b C T 17: 35,253,089 S368L probably damaging Het
Ddx60 A G 8: 61,972,220 K681E probably damaging Het
Dennd1c A C 17: 57,076,980 W15G possibly damaging Het
Dgkd T G 1: 87,941,501 probably null Het
Dnah7c G T 1: 46,665,990 A2388S probably benign Het
Etv4 C A 11: 101,770,498 K442N probably damaging Het
Fam234a T C 17: 26,213,558 D539G probably damaging Het
Fam71a A T 1: 191,163,008 N479K probably benign Het
Fancm A G 12: 65,120,530 T1538A probably benign Het
Fbn2 A T 18: 58,095,962 N725K possibly damaging Het
Fcer2a T A 8: 3,691,130 N4I possibly damaging Het
Fgd5 T C 6: 92,069,437 V1229A probably damaging Het
Gm5471 A T 15: 44,971,901 noncoding transcript Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm6729 C A 10: 86,541,166 noncoding transcript Het
Hectd4 G T 5: 121,277,834 probably null Het
Hspb3 A C 13: 113,663,491 M1R probably null Het
Igkv10-95 T C 6: 68,680,617 V19A probably damaging Het
Il1rap A G 16: 26,722,886 S626G probably benign Het
Ints9 A G 14: 64,990,554 H103R probably benign Het
Itga4 T A 2: 79,322,652 D894E probably damaging Het
Khsrp T C 17: 57,025,605 H225R probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lama1 A T 17: 67,812,486 I2653F probably damaging Het
Map4k5 A T 12: 69,845,723 L144Q probably damaging Het
Mcm5 A G 8: 75,115,854 Y252C probably damaging Het
Mmgt2 A G 11: 62,665,051 E75G probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Nckap5 A G 1: 126,222,706 V162A probably benign Het
Nr3c2 T C 8: 76,909,749 I493T probably damaging Het
Olfr1411 T C 1: 92,596,743 F75L probably benign Het
Olfr325 A T 11: 58,581,075 Y77F probably damaging Het
Olfr698 A C 7: 106,753,079 L103R probably damaging Het
Papola A G 12: 105,799,658 T6A possibly damaging Het
Ppp1cc G A 5: 122,168,226 R36Q probably benign Het
Ptpro G T 6: 137,420,372 W81C probably damaging Het
Rasgrf2 A G 13: 91,982,654 S162P possibly damaging Het
Rpusd2 T C 2: 119,038,715 S540P probably damaging Het
Scn5a T A 9: 119,486,372 T1757S probably damaging Het
Setbp1 T C 18: 78,856,991 I1154V probably benign Het
Sirt1 T C 10: 63,335,659 I209V probably null Het
Slco6c1 T A 1: 97,081,493 I406L probably benign Het
Smc2 A G 4: 52,450,947 E255G probably damaging Het
Snap91 C A 9: 86,777,049 G477V probably damaging Het
Speg A G 1: 75,427,904 Q2780R probably benign Het
Ssh2 A G 11: 77,421,269 Y196C probably damaging Het
Ssxb9 A T X: 8,369,606 T18S probably damaging Het
Stxbp5l T C 16: 37,208,119 I527M possibly damaging Het
Theg T C 10: 79,580,050 T236A probably damaging Het
Thoc3 T C 13: 54,468,548 D87G probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trps1 T C 15: 50,831,387 K213R probably damaging Het
Uggt1 A T 1: 36,158,159 L1221Q probably damaging Het
Vmn2r3 T A 3: 64,275,717 Y187F probably damaging Het
Washc2 G A 6: 116,258,930 E1121K probably damaging Het
Zfx T C X: 94,080,858 N360D probably damaging Het
Znhit3 A G 11: 84,916,313 V10A probably benign Het
Other mutations in Tex10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tex10 APN 4 48469937 nonsense probably null
IGL00832:Tex10 APN 4 48468864 missense probably benign
IGL01376:Tex10 APN 4 48456740 missense possibly damaging 0.90
IGL01594:Tex10 APN 4 48469906 missense possibly damaging 0.47
IGL02754:Tex10 APN 4 48435028 missense possibly damaging 0.46
IGL03071:Tex10 APN 4 48452946 missense probably benign 0.00
IGL03399:Tex10 APN 4 48459915 missense probably benign 0.04
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0544:Tex10 UTSW 4 48462766 splice site probably null
R0583:Tex10 UTSW 4 48451952 missense probably damaging 1.00
R0591:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0592:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0593:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0893:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1485:Tex10 UTSW 4 48436492 missense possibly damaging 0.54
R1703:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1704:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1706:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1911:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1912:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1930:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1983:Tex10 UTSW 4 48460059 missense possibly damaging 0.93
R2001:Tex10 UTSW 4 48451940 missense probably damaging 1.00
R2074:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2075:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2157:Tex10 UTSW 4 48436522 splice site probably benign
R3000:Tex10 UTSW 4 48459393 splice site probably null
R4067:Tex10 UTSW 4 48459355 nonsense probably null
R4081:Tex10 UTSW 4 48468873 missense probably benign 0.11
R4352:Tex10 UTSW 4 48452039 missense possibly damaging 0.77
R4364:Tex10 UTSW 4 48468774 missense probably benign 0.13
R4601:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4602:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4610:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4707:Tex10 UTSW 4 48468984 missense probably benign 0.00
R4744:Tex10 UTSW 4 48469990 missense probably benign 0.00
R4778:Tex10 UTSW 4 48436468 missense probably damaging 1.00
R4989:Tex10 UTSW 4 48458525 splice site probably benign
R5051:Tex10 UTSW 4 48460019 missense possibly damaging 0.86
R5120:Tex10 UTSW 4 48459272 missense possibly damaging 0.68
R5732:Tex10 UTSW 4 48460046 missense probably damaging 1.00
R5799:Tex10 UTSW 4 48433295 missense possibly damaging 0.62
R5813:Tex10 UTSW 4 48452928 missense probably benign 0.00
R6091:Tex10 UTSW 4 48459891 missense probably damaging 0.98
R6223:Tex10 UTSW 4 48468525 missense probably damaging 0.98
R6493:Tex10 UTSW 4 48436450 missense probably damaging 1.00
X0017:Tex10 UTSW 4 48460080 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGGGCACTTACCAAAGG -3'
(R):5'- AGTGTTCCGAAACCTGTATGTAG -3'

Sequencing Primer
(F):5'- TATTTTGGGGGCCAGGAATTGAAG -3'
(R):5'- CTTGAACAAGGACTTCAGCT -3'
Posted On2015-05-14