Mutagenetix > Incidental Mutations

Incidental Mutation 'R4133:Ptpro'

314742

Institutional Source

Beutler Lab

Gene Symbol

Ptpro

Ensembl Gene

ENSMUSG00000030223

Gene Name

protein tyrosine phosphatase, receptor type, O

Synonyms

Ptpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt

MMRRC Submission

041637-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4133 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137252319-137463233 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 137420372 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Cysteine at position 81 (W81C)

Ref Sequence

ENSEMBL: ENSMUSP00000131764 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077115
AA Change: W902C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: W902C

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	269	291	N/A	INTRINSIC
FN3	443	528	1.07e-1	SMART
FN3	540	626	7.07e-2	SMART
FN3	642	722	4.47e1	SMART
FN3	733	812	5.92e-4	SMART
transmembrane domain	831	853	N/A	INTRINSIC
transmembrane domain	890	912	N/A	INTRINSIC
PTPc	947	1207	1.43e-127	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167002
AA Change: W81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: W81C

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
transmembrane domain	69	91	N/A	INTRINSIC
PTPc	126	386	1.43e-127	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167679

SMART Domains

Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	269	291	N/A	INTRINSIC
FN3	443	528	1.07e-1	SMART
FN3	540	626	7.07e-2	SMART
FN3	642	722	4.47e1	SMART
FN3	733	812	5.92e-4	SMART
transmembrane domain	831	853	N/A	INTRINSIC
PTPc	919	1179	1.43e-127	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203914

SMART Domains

Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
PTPc	98	358	6.1e-130	SMART

Meta Mutation Damage Score

0.312

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	T	A	9: 60,769,998		noncoding transcript	Het
Aldh3b1	A	G	19: 3,920,808	I184T	probably damaging	Het
Arhgap42	C	T	9: 9,011,299		probably benign	Het
Arhgef4	A	G	1: 34,806,104	D1463G	probably damaging	Het
Arpc5	A	G	1: 152,768,871	T52A	probably benign	Het
Asb6	A	G	2: 30,828,235		probably benign	Het
Ash1l	T	C	3: 88,982,260	V482A	probably benign	Het
Bop1	T	C	15: 76,454,335	N469S	probably benign	Het
Btaf1	T	A	19: 36,961,738	N266K	probably benign	Het
Btla	T	C	16: 45,239,298	Y122H	probably damaging	Het
Cacna1g	A	G	11: 94,432,544	M1278T	probably damaging	Het
Cdc42bpb	A	G	12: 111,321,542	S524P	probably benign	Het
Cep78	A	G	19: 15,969,155	S438P	probably damaging	Het
Clca4a	T	G	3: 144,969,352	E171D	probably benign	Het
Cldn6	A	T	17: 23,681,493	I144F	probably damaging	Het
Cpd	G	A	11: 76,814,818	Q363*	probably null	Het
Cpn1	G	A	19: 43,986,284	P2L	possibly damaging	Het
Ddx31	A	G	2: 28,858,852	D264G	probably damaging	Het
Ddx39b	C	T	17: 35,253,089	S368L	probably damaging	Het
Ddx60	A	G	8: 61,972,220	K681E	probably damaging	Het
Dennd1c	A	C	17: 57,076,980	W15G	possibly damaging	Het
Dgkd	T	G	1: 87,941,501		probably null	Het
Dnah7c	G	T	1: 46,665,990	A2388S	probably benign	Het
Etv4	C	A	11: 101,770,498	K442N	probably damaging	Het
Fam234a	T	C	17: 26,213,558	D539G	probably damaging	Het
Fam71a	A	T	1: 191,163,008	N479K	probably benign	Het
Fancm	A	G	12: 65,120,530	T1538A	probably benign	Het
Fbn2	A	T	18: 58,095,962	N725K	possibly damaging	Het
Fcer2a	T	A	8: 3,691,130	N4I	possibly damaging	Het
Fgd5	T	C	6: 92,069,437	V1229A	probably damaging	Het
Gm5471	A	T	15: 44,971,901		noncoding transcript	Het
Gm5478	T	A	15: 101,644,645	I331F	probably damaging	Het
Gm6729	C	A	10: 86,541,166		noncoding transcript	Het
Hectd4	G	T	5: 121,277,834		probably null	Het
Hspb3	A	C	13: 113,663,491	M1R	probably null	Het
Igkv10-95	T	C	6: 68,680,617	V19A	probably damaging	Het
Il1rap	A	G	16: 26,722,886	S626G	probably benign	Het
Ints9	A	G	14: 64,990,554	H103R	probably benign	Het
Itga4	T	A	2: 79,322,652	D894E	probably damaging	Het
Khsrp	T	C	17: 57,025,605	H225R	probably benign	Het
Lama1	T	C	17: 67,750,655	Y575H	probably damaging	Het
Lama1	A	T	17: 67,812,486	I2653F	probably damaging	Het
Map4k5	A	T	12: 69,845,723	L144Q	probably damaging	Het
Mcm5	A	G	8: 75,115,854	Y252C	probably damaging	Het
Mmgt2	A	G	11: 62,665,051	E75G	probably damaging	Het
Mroh2a	A	T	1: 88,254,965	N1205I	possibly damaging	Het
Nckap5	A	G	1: 126,222,706	V162A	probably benign	Het
Nr3c2	T	C	8: 76,909,749	I493T	probably damaging	Het
Olfr1411	T	C	1: 92,596,743	F75L	probably benign	Het
Olfr325	A	T	11: 58,581,075	Y77F	probably damaging	Het
Olfr698	A	C	7: 106,753,079	L103R	probably damaging	Het
Papola	A	G	12: 105,799,658	T6A	possibly damaging	Het
Ppp1cc	G	A	5: 122,168,226	R36Q	probably benign	Het
Rasgrf2	A	G	13: 91,982,654	S162P	possibly damaging	Het
Rpusd2	T	C	2: 119,038,715	S540P	probably damaging	Het
Scn5a	T	A	9: 119,486,372	T1757S	probably damaging	Het
Setbp1	T	C	18: 78,856,991	I1154V	probably benign	Het
Sirt1	T	C	10: 63,335,659	I209V	probably null	Het
Slco6c1	T	A	1: 97,081,493	I406L	probably benign	Het
Smc2	A	G	4: 52,450,947	E255G	probably damaging	Het
Snap91	C	A	9: 86,777,049	G477V	probably damaging	Het
Speg	A	G	1: 75,427,904	Q2780R	probably benign	Het
Ssh2	A	G	11: 77,421,269	Y196C	probably damaging	Het
Ssxb9	A	T	X: 8,369,606	T18S	probably damaging	Het
Stxbp5l	T	C	16: 37,208,119	I527M	possibly damaging	Het
Tex10	T	C	4: 48,468,968	Y69C	probably damaging	Het
Theg	T	C	10: 79,580,050	T236A	probably damaging	Het
Thoc3	T	C	13: 54,468,548	D87G	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trps1	T	C	15: 50,831,387	K213R	probably damaging	Het
Uggt1	A	T	1: 36,158,159	L1221Q	probably damaging	Het
Vmn2r3	T	A	3: 64,275,717	Y187F	probably damaging	Het
Washc2	G	A	6: 116,258,930	E1121K	probably damaging	Het
Zfx	T	C	X: 94,080,858	N360D	probably damaging	Het
Znhit3	A	G	11: 84,916,313	V10A	probably benign	Het

Other mutations in Ptpro

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ptpro	APN	6	137394909	critical splice donor site	probably null
IGL00844:Ptpro	APN	6	137414239	missense	probably damaging	1.00
IGL00983:Ptpro	APN	6	137418248	missense	probably benign	0.01
IGL01073:Ptpro	APN	6	137377088	missense	probably damaging	1.00
IGL01832:Ptpro	APN	6	137393668	missense	possibly damaging	0.93
IGL02308:Ptpro	APN	6	137454700	missense	probably benign	0.37
IGL02387:Ptpro	APN	6	137410980	missense	probably damaging	0.96
IGL02605:Ptpro	APN	6	137380318	missense	probably benign	0.02
IGL02666:Ptpro	APN	6	137378059	missense	probably damaging	0.96
IGL03275:Ptpro	APN	6	137450006	missense	probably damaging	1.00
court	UTSW	6	137393675	nonsense	probably null
R0017:Ptpro	UTSW	6	137416827	missense	probably benign	0.03
R0017:Ptpro	UTSW	6	137416827	missense	probably benign	0.03
R0020:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0022:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0023:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0024:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0094:Ptpro	UTSW	6	137386352	missense	probably benign	0.08
R0094:Ptpro	UTSW	6	137386352	missense	probably benign	0.08
R0103:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0106:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0316:Ptpro	UTSW	6	137376989	missense	possibly damaging	0.81
R0427:Ptpro	UTSW	6	137368296	missense	possibly damaging	0.81
R0456:Ptpro	UTSW	6	137414230	missense	probably benign	0.04
R0536:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0537:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0552:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0555:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0664:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0708:Ptpro	UTSW	6	137386253	missense	probably benign	0.26
R0730:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0735:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0738:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0786:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0811:Ptpro	UTSW	6	137368079	missense	probably benign	0.00
R0812:Ptpro	UTSW	6	137368079	missense	probably benign	0.00
R0881:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0973:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1145:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1145:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1146:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1146:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1147:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1147:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1259:Ptpro	UTSW	6	137392741	missense	probably damaging	0.98
R1340:Ptpro	UTSW	6	137441081	missense	possibly damaging	0.95
R1381:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1382:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1385:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1396:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1401:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1416:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1422:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1448:Ptpro	UTSW	6	137441116	missense	probably damaging	1.00
R1513:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1518:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1526:Ptpro	UTSW	6	137461726	missense	probably damaging	1.00
R1540:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1571:Ptpro	UTSW	6	137378130	missense	probably benign
R1573:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1587:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1588:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1649:Ptpro	UTSW	6	137444017	nonsense	probably null
R1700:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1701:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1745:Ptpro	UTSW	6	137400645	missense	probably benign	0.03
R1772:Ptpro	UTSW	6	137430743	missense	probably damaging	1.00
R1911:Ptpro	UTSW	6	137400619	splice site	probably benign
R1958:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1967:Ptpro	UTSW	6	137416865	missense	probably benign	0.38
R2025:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2026:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2040:Ptpro	UTSW	6	137386164	splice site	probably benign
R2115:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2117:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2130:Ptpro	UTSW	6	137411116	splice site	probably null
R2161:Ptpro	UTSW	6	137449887	missense	probably benign	0.01
R2431:Ptpro	UTSW	6	137443585	nonsense	probably null
R2915:Ptpro	UTSW	6	137414241	start gained	probably benign
R2988:Ptpro	UTSW	6	137443599	nonsense	probably null
R3772:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3773:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3795:Ptpro	UTSW	6	137380309	missense	probably benign
R3885:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3886:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3887:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3888:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3893:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R4032:Ptpro	UTSW	6	137461742	missense	probably damaging	1.00
R4377:Ptpro	UTSW	6	137380266	missense	probably benign	0.26
R4455:Ptpro	UTSW	6	137393659	missense	probably damaging	1.00
R4613:Ptpro	UTSW	6	137416836	nonsense	probably null
R4827:Ptpro	UTSW	6	137442710	missense	probably damaging	1.00
R4863:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R4870:Ptpro	UTSW	6	137377132	missense	probably damaging	0.96
R4910:Ptpro	UTSW	6	137368338	missense	probably damaging	0.99
R4932:Ptpro	UTSW	6	137411105	nonsense	probably null
R4941:Ptpro	UTSW	6	137392765	missense	probably damaging	1.00
R4989:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5009:Ptpro	UTSW	6	137377132	missense	probably damaging	0.96
R5032:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5033:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5162:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5393:Ptpro	UTSW	6	137380224	missense	probably benign	0.04
R5423:Ptpro	UTSW	6	137442707	missense	probably damaging	1.00
R5782:Ptpro	UTSW	6	137399498	missense	possibly damaging	0.80
R6103:Ptpro	UTSW	6	137400706	missense	possibly damaging	0.76
R6239:Ptpro	UTSW	6	137380608	missense	probably benign	0.28
R6488:Ptpro	UTSW	6	137393675	nonsense	probably null
R6494:Ptpro	UTSW	6	137382642	missense	probably benign	0.20
R6746:Ptpro	UTSW	6	137394823	missense	probably damaging	1.00
R6763:Ptpro	UTSW	6	137418281	splice site	probably null
R6888:Ptpro	UTSW	6	137380200	missense	probably benign	0.30
R6983:Ptpro	UTSW	6	137449917	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCATTGGAAGCCTACAGAGGG -3'
(R):5'- TAGCGCTCACTGTCTCGATG -3'

Sequencing Primer
(F):5'- GGAATACCCTTTAACTATGGTGTG -3'
(R):5'- GTCTCGATGCCTCTCCACTTG -3'

Posted On

2015-05-14