Incidental Mutation 'R4133:Rasgrf2'
ID314766
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission 041637-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R4133 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91982654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 162 (S162P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
Predicted Effect probably benign
Transcript: ENSMUST00000099326
AA Change: S763P

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: S763P

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142378
AA Change: S162P

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: S162P

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
Blast:RasGEFN 187 249 8e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151408
AA Change: S162P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: S162P

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,769,998 noncoding transcript Het
Aldh3b1 A G 19: 3,920,808 I184T probably damaging Het
Arhgap42 C T 9: 9,011,299 probably benign Het
Arhgef4 A G 1: 34,806,104 D1463G probably damaging Het
Arpc5 A G 1: 152,768,871 T52A probably benign Het
Asb6 A G 2: 30,828,235 probably benign Het
Ash1l T C 3: 88,982,260 V482A probably benign Het
Bop1 T C 15: 76,454,335 N469S probably benign Het
Btaf1 T A 19: 36,961,738 N266K probably benign Het
Btla T C 16: 45,239,298 Y122H probably damaging Het
Cacna1g A G 11: 94,432,544 M1278T probably damaging Het
Cdc42bpb A G 12: 111,321,542 S524P probably benign Het
Cep78 A G 19: 15,969,155 S438P probably damaging Het
Clca4a T G 3: 144,969,352 E171D probably benign Het
Cldn6 A T 17: 23,681,493 I144F probably damaging Het
Cpd G A 11: 76,814,818 Q363* probably null Het
Cpn1 G A 19: 43,986,284 P2L possibly damaging Het
Ddx31 A G 2: 28,858,852 D264G probably damaging Het
Ddx39b C T 17: 35,253,089 S368L probably damaging Het
Ddx60 A G 8: 61,972,220 K681E probably damaging Het
Dennd1c A C 17: 57,076,980 W15G possibly damaging Het
Dgkd T G 1: 87,941,501 probably null Het
Dnah7c G T 1: 46,665,990 A2388S probably benign Het
Etv4 C A 11: 101,770,498 K442N probably damaging Het
Fam234a T C 17: 26,213,558 D539G probably damaging Het
Fam71a A T 1: 191,163,008 N479K probably benign Het
Fancm A G 12: 65,120,530 T1538A probably benign Het
Fbn2 A T 18: 58,095,962 N725K possibly damaging Het
Fcer2a T A 8: 3,691,130 N4I possibly damaging Het
Fgd5 T C 6: 92,069,437 V1229A probably damaging Het
Gm5471 A T 15: 44,971,901 noncoding transcript Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm6729 C A 10: 86,541,166 noncoding transcript Het
Hectd4 G T 5: 121,277,834 probably null Het
Hspb3 A C 13: 113,663,491 M1R probably null Het
Igkv10-95 T C 6: 68,680,617 V19A probably damaging Het
Il1rap A G 16: 26,722,886 S626G probably benign Het
Ints9 A G 14: 64,990,554 H103R probably benign Het
Itga4 T A 2: 79,322,652 D894E probably damaging Het
Khsrp T C 17: 57,025,605 H225R probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lama1 A T 17: 67,812,486 I2653F probably damaging Het
Map4k5 A T 12: 69,845,723 L144Q probably damaging Het
Mcm5 A G 8: 75,115,854 Y252C probably damaging Het
Mmgt2 A G 11: 62,665,051 E75G probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Nckap5 A G 1: 126,222,706 V162A probably benign Het
Nr3c2 T C 8: 76,909,749 I493T probably damaging Het
Olfr1411 T C 1: 92,596,743 F75L probably benign Het
Olfr325 A T 11: 58,581,075 Y77F probably damaging Het
Olfr698 A C 7: 106,753,079 L103R probably damaging Het
Papola A G 12: 105,799,658 T6A possibly damaging Het
Ppp1cc G A 5: 122,168,226 R36Q probably benign Het
Ptpro G T 6: 137,420,372 W81C probably damaging Het
Rpusd2 T C 2: 119,038,715 S540P probably damaging Het
Scn5a T A 9: 119,486,372 T1757S probably damaging Het
Setbp1 T C 18: 78,856,991 I1154V probably benign Het
Sirt1 T C 10: 63,335,659 I209V probably null Het
Slco6c1 T A 1: 97,081,493 I406L probably benign Het
Smc2 A G 4: 52,450,947 E255G probably damaging Het
Snap91 C A 9: 86,777,049 G477V probably damaging Het
Speg A G 1: 75,427,904 Q2780R probably benign Het
Ssh2 A G 11: 77,421,269 Y196C probably damaging Het
Ssxb9 A T X: 8,369,606 T18S probably damaging Het
Stxbp5l T C 16: 37,208,119 I527M possibly damaging Het
Tex10 T C 4: 48,468,968 Y69C probably damaging Het
Theg T C 10: 79,580,050 T236A probably damaging Het
Thoc3 T C 13: 54,468,548 D87G probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trps1 T C 15: 50,831,387 K213R probably damaging Het
Uggt1 A T 1: 36,158,159 L1221Q probably damaging Het
Vmn2r3 T A 3: 64,275,717 Y187F probably damaging Het
Washc2 G A 6: 116,258,930 E1121K probably damaging Het
Zfx T C X: 94,080,858 N360D probably damaging Het
Znhit3 A G 11: 84,916,313 V10A probably benign Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
R7469:Rasgrf2 UTSW 13 92029022 critical splice donor site probably null
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAATACTTCGTCTGGGCCTTC -3'
(R):5'- TCGTGCGTGATATCTGAGTC -3'

Sequencing Primer
(F):5'- CTATTCAGATCTCCATGGGGC -3'
(R):5'- TTTTTGCCACAAGCCAGAAC -3'
Posted On2015-05-14