Incidental Mutation 'R4134:Dennd2d'
ID314798
Institutional Source Beutler Lab
Gene Symbol Dennd2d
Ensembl Gene ENSMUSG00000027901
Gene NameDENN/MADD domain containing 2D
Synonyms2010308M01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4134 (G1)
Quality Score222
Status Not validated
Chromosome3
Chromosomal Location106482405-106503030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106482661 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2 (D2E)
Ref Sequence ENSEMBL: ENSMUSP00000029508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029508] [ENSMUST00000149225] [ENSMUST00000183271]
Predicted Effect probably benign
Transcript: ENSMUST00000029508
AA Change: D2E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029508
Gene: ENSMUSG00000027901
AA Change: D2E

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
uDENN 47 139 4.15e-27 SMART
DENN 146 330 8.1e-71 SMART
dDENN 368 435 3.38e-18 SMART
low complexity region 447 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139062
Predicted Effect unknown
Transcript: ENSMUST00000149225
AA Change: D2E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164330
SMART Domains Protein: ENSMUSP00000127168
Gene: ENSMUSG00000091575

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183271
SMART Domains Protein: ENSMUSP00000138462
Gene: ENSMUSG00000027901

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
uDENN 57 149 4.15e-27 SMART
DENN 156 340 8.1e-71 SMART
dDENN 378 445 3.38e-18 SMART
low complexity region 457 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193651
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1g T C 8: 93,319,872 T342A probably benign Het
Clip2 A G 5: 134,492,253 V977A probably benign Het
Cnot11 T C 1: 39,537,548 V211A probably benign Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
F2 T C 2: 91,629,208 D410G possibly damaging Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Greb1l T C 18: 10,529,708 probably null Het
Gtdc1 A G 2: 44,825,418 W38R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 A T 4: 137,556,657 Q3446L probably damaging Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Itgb4 G T 11: 116,006,470 G1454V probably benign Het
Lrrc9 T C 12: 72,466,966 S534P probably benign Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Npm2 C T 14: 70,648,382 E128K possibly damaging Het
Nyap2 A G 1: 81,241,193 D310G probably damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pum1 A T 4: 130,764,069 I770F probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Syt9 A G 7: 107,436,423 S216G probably benign Het
Tep1 G A 14: 50,844,860 H1120Y probably benign Het
Ttn T A 2: 76,884,794 probably benign Het
Vmn1r8 A G 6: 57,036,720 D252G probably benign Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Zfhx2 G A 14: 55,065,143 P1795S possibly damaging Het
Zfhx4 T C 3: 5,243,627 S638P probably damaging Het
Zfp677 A G 17: 21,397,781 T367A probably benign Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Dennd2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Dennd2d APN 3 106500545 missense possibly damaging 0.45
IGL01397:Dennd2d APN 3 106487049 critical splice donor site probably null 0.00
IGL01410:Dennd2d APN 3 106491226 missense probably damaging 1.00
IGL02022:Dennd2d APN 3 106499904 missense probably benign 0.00
IGL02032:Dennd2d APN 3 106491227 missense probably damaging 1.00
IGL02309:Dennd2d APN 3 106494968 missense probably benign
R0140:Dennd2d UTSW 3 106492483 missense probably benign 0.08
R0648:Dennd2d UTSW 3 106500555 missense probably damaging 0.97
R1519:Dennd2d UTSW 3 106492559 missense probably damaging 1.00
R1539:Dennd2d UTSW 3 106486920 missense probably benign 0.00
R1652:Dennd2d UTSW 3 106487001 missense probably benign 0.00
R1674:Dennd2d UTSW 3 106492517 missense probably benign 0.17
R2179:Dennd2d UTSW 3 106492460 missense probably benign 0.00
R3731:Dennd2d UTSW 3 106499955 missense probably damaging 1.00
R4077:Dennd2d UTSW 3 106482623 unclassified probably benign
R4135:Dennd2d UTSW 3 106482661 missense probably benign 0.34
R5214:Dennd2d UTSW 3 106486321 critical splice donor site probably null
R5767:Dennd2d UTSW 3 106487815 intron probably benign
R6001:Dennd2d UTSW 3 106492460 missense probably benign 0.00
R6239:Dennd2d UTSW 3 106494877 missense probably damaging 1.00
R7312:Dennd2d UTSW 3 106491263 missense probably benign 0.38
Z1088:Dennd2d UTSW 3 106499874 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATGAGATGGTACCGCC -3'
(R):5'- AGCAGATCTGTCCCCTTGTTG -3'

Sequencing Primer
(F):5'- AGATGGTACCGCCCCTCC -3'
(R):5'- GAGCTCACCTGCCTCCTG -3'
Posted On2015-05-14