Incidental Mutation 'R4134:Lrrc9'
ID314814
Institutional Source Beutler Lab
Gene Symbol Lrrc9
Ensembl Gene ENSMUSG00000021090
Gene Nameleucine rich repeat containing 9
Synonyms4930432K16Rik, 4921529O18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R4134 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72441866-72530750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72466966 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 534 (S534P)
Ref Sequence ENSEMBL: ENSMUSP00000124602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000221360]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161195
Predicted Effect probably benign
Transcript: ENSMUST00000161284
AA Change: S534P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090
AA Change: S534P

DomainStartEndE-ValueType
Pfam:LRR_4 77 118 2.8e-11 PFAM
LRR 119 140 8.49e1 SMART
LRR 141 164 2.27e1 SMART
LRR 165 187 2.09e2 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 706 727 1.41e2 SMART
LRR 728 749 6.78e1 SMART
LRR 750 773 7.17e1 SMART
LRRcap 793 811 2.26e2 SMART
LRR 943 966 2.67e-1 SMART
LRR 967 992 1.22e1 SMART
LRRcap 1031 1049 4.37e0 SMART
low complexity region 1109 1120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161957
Predicted Effect probably benign
Transcript: ENSMUST00000162159
AA Change: S533P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: S533P

DomainStartEndE-ValueType
LRR 53 74 5.39e2 SMART
LRR 75 96 1.14e2 SMART
LRR 97 118 7.9e-4 SMART
LRR 119 140 2.75e-3 SMART
LRR 141 164 2.27e1 SMART
LRR 164 185 1.87e1 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 705 726 1.41e2 SMART
LRR 727 748 6.78e1 SMART
LRR 749 771 1.37e1 SMART
LRRcap 792 810 2.26e2 SMART
LRR 898 919 2.62e1 SMART
LRR 920 941 5.17e1 SMART
LRR 942 965 2.67e-1 SMART
LRR 966 991 1.22e1 SMART
LRR 1013 1032 4.42e2 SMART
LRRcap 1030 1048 4.37e0 SMART
low complexity region 1108 1119 N/A INTRINSIC
LRR 1128 1150 2.4e1 SMART
LRR 1191 1209 5.7e2 SMART
LRR 1215 1236 1.03e-2 SMART
LRR 1237 1260 8.48e0 SMART
LRR 1283 1304 2.67e-1 SMART
Blast:LRR 1308 1333 4e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162179
Predicted Effect probably benign
Transcript: ENSMUST00000221360
AA Change: S534P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1g T C 8: 93,319,872 T342A probably benign Het
Clip2 A G 5: 134,492,253 V977A probably benign Het
Cnot11 T C 1: 39,537,548 V211A probably benign Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
F2 T C 2: 91,629,208 D410G possibly damaging Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Greb1l T C 18: 10,529,708 probably null Het
Gtdc1 A G 2: 44,825,418 W38R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 A T 4: 137,556,657 Q3446L probably damaging Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Itgb4 G T 11: 116,006,470 G1454V probably benign Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Npm2 C T 14: 70,648,382 E128K possibly damaging Het
Nyap2 A G 1: 81,241,193 D310G probably damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pum1 A T 4: 130,764,069 I770F probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Syt9 A G 7: 107,436,423 S216G probably benign Het
Tep1 G A 14: 50,844,860 H1120Y probably benign Het
Ttn T A 2: 76,884,794 probably benign Het
Vmn1r8 A G 6: 57,036,720 D252G probably benign Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Zfhx2 G A 14: 55,065,143 P1795S possibly damaging Het
Zfhx4 T C 3: 5,243,627 S638P probably damaging Het
Zfp677 A G 17: 21,397,781 T367A probably benign Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Lrrc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Lrrc9 APN 12 72486243 missense possibly damaging 0.63
IGL00843:Lrrc9 APN 12 72463417 missense possibly damaging 0.78
IGL01923:Lrrc9 APN 12 72510412 missense possibly damaging 0.93
IGL02027:Lrrc9 APN 12 72470334 splice site probably benign
IGL02271:Lrrc9 APN 12 72510381 missense probably benign 0.06
IGL02398:Lrrc9 APN 12 72466903 missense probably benign
IGL02795:Lrrc9 APN 12 72478768 missense probably damaging 1.00
IGL02931:Lrrc9 APN 12 72454149 missense probably damaging 1.00
IGL03257:Lrrc9 APN 12 72449768 missense probably benign
IGL02799:Lrrc9 UTSW 12 72506404 missense probably damaging 1.00
R0172:Lrrc9 UTSW 12 72463486 missense possibly damaging 0.50
R0315:Lrrc9 UTSW 12 72456028 missense probably damaging 0.96
R0492:Lrrc9 UTSW 12 72478763 missense possibly damaging 0.47
R0617:Lrrc9 UTSW 12 72483014 missense probably damaging 1.00
R0639:Lrrc9 UTSW 12 72486288 missense probably damaging 1.00
R0987:Lrrc9 UTSW 12 72510382 missense probably benign 0.00
R1325:Lrrc9 UTSW 12 72497104 missense probably damaging 0.99
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1479:Lrrc9 UTSW 12 72460825 nonsense probably null
R1564:Lrrc9 UTSW 12 72487053 missense probably damaging 1.00
R1626:Lrrc9 UTSW 12 72495661 unclassified probably null
R1632:Lrrc9 UTSW 12 72460020 splice site probably null
R1715:Lrrc9 UTSW 12 72477299 missense probably damaging 1.00
R1743:Lrrc9 UTSW 12 72456117 missense probably damaging 1.00
R1779:Lrrc9 UTSW 12 72455998 nonsense probably null
R1866:Lrrc9 UTSW 12 72497138 missense probably damaging 0.97
R1878:Lrrc9 UTSW 12 72476164 critical splice donor site probably null
R1990:Lrrc9 UTSW 12 72497861 missense probably damaging 0.99
R2361:Lrrc9 UTSW 12 72463470 missense possibly damaging 0.52
R3752:Lrrc9 UTSW 12 72460806 nonsense probably null
R3833:Lrrc9 UTSW 12 72482991 missense probably damaging 1.00
R4651:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4652:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4659:Lrrc9 UTSW 12 72470264 missense probably damaging 1.00
R4831:Lrrc9 UTSW 12 72499679 missense probably damaging 1.00
R4857:Lrrc9 UTSW 12 72499692 missense possibly damaging 0.94
R5017:Lrrc9 UTSW 12 72506325 missense possibly damaging 0.86
R5163:Lrrc9 UTSW 12 72449389 missense probably damaging 1.00
R5279:Lrrc9 UTSW 12 72495594 missense possibly damaging 0.80
R5434:Lrrc9 UTSW 12 72454088 missense probably damaging 0.98
R5783:Lrrc9 UTSW 12 72456053 missense possibly damaging 0.62
R6021:Lrrc9 UTSW 12 72469231 missense probably damaging 0.97
R6214:Lrrc9 UTSW 12 72459853 missense probably damaging 1.00
R6255:Lrrc9 UTSW 12 72487023 missense probably benign 0.33
R6538:Lrrc9 UTSW 12 72500929 missense probably benign 0.08
R6563:Lrrc9 UTSW 12 72486395 splice site probably null
R6672:Lrrc9 UTSW 12 72473936 missense possibly damaging 0.88
R6919:Lrrc9 UTSW 12 72506393 missense probably benign 0.01
R6929:Lrrc9 UTSW 12 72450772 missense probably benign 0.41
R7092:Lrrc9 UTSW 12 72463464 missense possibly damaging 0.81
R7150:Lrrc9 UTSW 12 72466952 missense probably benign 0.00
X0025:Lrrc9 UTSW 12 72497060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCATCCAAGTAGAAATGC -3'
(R):5'- CTTCCTAGGGTTGGTAGACAAG -3'

Sequencing Primer
(F):5'- CTTGTGAACAGCCTCAGT -3'
(R):5'- GTCCAACTGACAGTGCAGC -3'
Posted On2015-05-14