Incidental Mutation 'R4151:Cfap45'
ID314880
Institutional Source Beutler Lab
Gene Symbol Cfap45
Ensembl Gene ENSMUSG00000026546
Gene Namecilia and flagella associated protein 45
Synonyms1700028D05Rik, Nesg1, Ccdc19
MMRRC Submission 040861-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R4151 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172520801-172545870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172532221 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 96 (I96N)
Ref Sequence ENSEMBL: ENSMUSP00000125225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085894] [ENSMUST00000159395] [ENSMUST00000159792] [ENSMUST00000161140] [ENSMUST00000162988]
Predicted Effect probably benign
Transcript: ENSMUST00000085894
AA Change: I138N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083057
Gene: ENSMUSG00000026546
AA Change: I138N

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:TPH 187 532 1.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159395
AA Change: I109N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125224
Gene: ENSMUSG00000026546
AA Change: I109N

DomainStartEndE-ValueType
coiled coil region 128 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159792
AA Change: I109N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124540
Gene: ENSMUSG00000026546
AA Change: I109N

DomainStartEndE-ValueType
coiled coil region 128 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160531
Predicted Effect probably damaging
Transcript: ENSMUST00000161140
AA Change: I96N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000162988
AA Change: I109N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,836,254 S695R possibly damaging Het
Ano10 C T 9: 122,261,535 W237* probably null Het
Armc9 C T 1: 86,164,775 T87M probably damaging Het
Astn2 C T 4: 65,729,320 probably null Het
Atxn7l1 G A 12: 33,364,482 V506M probably damaging Het
Cenpe A G 3: 135,215,153 N36D probably benign Het
Cyp8b1 A T 9: 121,916,068 V66D probably damaging Het
Dnajb6 C G 5: 29,756,236 L118V probably benign Het
Dpy19l4 A G 4: 11,309,485 S44P possibly damaging Het
Dync2li1 A G 17: 84,628,335 H20R probably benign Het
Eif3g T C 9: 20,895,133 D220G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Gata2 T A 6: 88,199,638 H26Q probably damaging Het
Gle1 T C 2: 29,944,044 I434T probably damaging Het
Gm5145 A G 17: 20,571,098 E246G probably damaging Het
Ints10 T A 8: 68,794,598 probably null Het
Kdr G T 5: 75,957,101 A664E possibly damaging Het
Klhl1 A C 14: 96,518,316 M1R probably null Het
Lama4 T A 10: 39,005,428 F71Y probably benign Het
Madd C A 2: 91,143,083 R1410L probably benign Het
Magi2 T C 5: 19,227,292 S2P probably damaging Het
Map4k3 T C 17: 80,644,534 K228R probably damaging Het
Mrpl43 A G 19: 45,005,736 L148P possibly damaging Het
Msi2 G C 11: 88,718,044 S16C probably damaging Het
Myo1e G T 9: 70,297,351 G78* probably null Het
Notch2 T C 3: 98,147,071 L2350S possibly damaging Het
Nptn G T 9: 58,643,542 S168I probably benign Het
Nsmce2 A G 15: 59,601,365 T244A probably benign Het
Olfr1109 C T 2: 87,093,170 V76I probably benign Het
Ostn T A 16: 27,321,402 S22T probably benign Het
Plekhb2 T G 1: 34,864,483 F102V probably benign Het
Prkdc A G 16: 15,816,773 D3594G probably benign Het
Psmd6 G C 14: 14,120,157 L61V probably benign Het
Rbm33 C T 5: 28,387,940 P573S probably damaging Het
Rfk A C 19: 17,395,308 I65L probably benign Het
Rnf141 A T 7: 110,837,199 D7E probably benign Het
Shank2 A T 7: 144,054,828 K153M probably damaging Het
Slc30a2 A T 4: 134,344,048 I31F probably benign Het
Slco3a1 G T 7: 74,359,838 A243E probably damaging Het
Stab2 G A 10: 87,002,983 T73I probably benign Het
Sufu G A 19: 46,449,972 probably null Het
Sync C T 4: 129,293,726 Q184* probably null Het
Tnfrsf25 G T 4: 152,119,801 A376S probably damaging Het
Tnpo1 A T 13: 98,852,899 I765N probably damaging Het
Ube2d2b A T 5: 107,830,881 K133* probably null Het
Ulk3 C T 9: 57,592,367 S217L possibly damaging Het
Upf2 C A 2: 5,961,705 Q379K unknown Het
Vegfc T A 8: 54,077,789 L4Q unknown Het
Vmn2r104 A T 17: 20,029,885 I708N probably damaging Het
Other mutations in Cfap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cfap45 APN 1 172535345 unclassified probably benign
IGL01936:Cfap45 APN 1 172534049 missense probably damaging 1.00
IGL03235:Cfap45 APN 1 172538493 missense possibly damaging 0.55
R0194:Cfap45 UTSW 1 172541327 missense probably benign 0.05
R0883:Cfap45 UTSW 1 172532189 missense possibly damaging 0.90
R1130:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1168:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1356:Cfap45 UTSW 1 172527863 missense possibly damaging 0.53
R1522:Cfap45 UTSW 1 172540572 missense probably damaging 1.00
R1921:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R1922:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R2203:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2204:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2205:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R3156:Cfap45 UTSW 1 172545724 missense possibly damaging 0.93
R4059:Cfap45 UTSW 1 172538489 missense probably benign 0.00
R4445:Cfap45 UTSW 1 172535227 missense probably benign 0.07
R4548:Cfap45 UTSW 1 172545108 missense probably benign 0.00
R4582:Cfap45 UTSW 1 172529912 missense probably benign 0.42
R4909:Cfap45 UTSW 1 172529876 missense probably benign 0.14
R5200:Cfap45 UTSW 1 172545129 nonsense probably null
R5800:Cfap45 UTSW 1 172538600 missense probably damaging 0.98
R6520:Cfap45 UTSW 1 172540584 missense probably damaging 1.00
R6662:Cfap45 UTSW 1 172529850 missense probably benign 0.01
R7390:Cfap45 UTSW 1 172541358 missense probably benign 0.00
R7468:Cfap45 UTSW 1 172535310 nonsense probably null
R7545:Cfap45 UTSW 1 172538596 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCATGAATTTGCAGGCTC -3'
(R):5'- TCCCTCACTTATCAGAGCTGAG -3'

Sequencing Primer
(F):5'- CATGAATTTGCAGGCTCTTCTG -3'
(R):5'- CTCACTTATCAGAGCTGAGAGGTC -3'
Posted On2015-05-14