Incidental Mutation 'R0389:Unc13a'
ID31490
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 038595-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0389 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71658032 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 464 (F464L)
Ref Sequence ENSEMBL: ENSMUSP00000135189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect probably benign
Transcript: ENSMUST00000030170
AA Change: F464L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: F464L

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175780
Predicted Effect unknown
Transcript: ENSMUST00000176426
AA Change: F107L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176777
Predicted Effect probably benign
Transcript: ENSMUST00000177517
AA Change: F464L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: F464L

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,671,404 E30K unknown Het
Abi3bp A T 16: 56,671,307 T1319S possibly damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Adgre1 G A 17: 57,406,839 D175N possibly damaging Het
Adgrf1 T C 17: 43,303,788 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Anks1 A G 17: 27,995,952 R458G possibly damaging Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1g C T 11: 94,459,697 V441M probably damaging Het
Cadps2 A T 6: 23,321,782 V1037E possibly damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cenpq T C 17: 40,933,194 probably benign Het
Chrac1 T C 15: 73,093,527 I93T possibly damaging Het
Cntnap2 T A 6: 46,009,637 S359T probably benign Het
Col6a6 C A 9: 105,784,204 M235I probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Cyp1a2 T C 9: 57,682,025 N169D probably benign Het
Dennd1c T A 17: 57,067,649 T499S probably benign Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Eif3h C A 15: 51,799,264 V129F probably damaging Het
Eno2 A G 6: 124,762,691 F380L probably damaging Het
Ergic2 T A 6: 148,183,202 I34F probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam185a C T 5: 21,459,285 T339M probably damaging Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Fam71f2 T A 6: 29,281,392 V43E possibly damaging Het
Fasn G T 11: 120,816,182 D881E probably damaging Het
Fat1 C A 8: 44,950,348 H45Q probably benign Het
Fbxw16 A T 9: 109,432,482 C439S probably benign Het
Gba2 A T 4: 43,570,832 F280Y probably damaging Het
Gfm1 A G 3: 67,457,918 I517V probably benign Het
Gng13 C T 17: 25,718,722 Q8* probably null Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gphn A T 12: 78,590,659 I381F probably damaging Het
Grm3 T C 5: 9,504,794 N833D probably damaging Het
Gstt2 G T 10: 75,832,432 T163K probably damaging Het
Gusb A T 5: 129,998,086 V388E probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hspg2 A G 4: 137,515,423 T650A possibly damaging Het
Ints2 C T 11: 86,248,851 V306I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Klhl18 A T 9: 110,428,681 C564S probably benign Het
Krt40 T A 11: 99,541,714 R159* probably null Het
L3mbtl4 G A 17: 68,455,780 V103M probably damaging Het
Lnx2 C A 5: 147,019,040 V649L possibly damaging Het
Lpp A T 16: 24,608,241 Q39H probably damaging Het
Lrpprc A T 17: 84,753,112 probably null Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Mbtps2 G T X: 157,568,368 T134K probably benign Het
Mfng C T 15: 78,764,437 V147M possibly damaging Het
Mks1 T C 11: 87,857,928 S273P probably benign Het
Myh2 T C 11: 67,180,821 L488P probably damaging Het
Myo15 A G 11: 60,478,538 N708S probably benign Het
Myo6 A T 9: 80,292,466 N1019I probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Ncoa1 T G 12: 4,295,976 N457T probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nlrp4e C A 7: 23,355,203 N927K probably damaging Het
Npffr2 T C 5: 89,582,754 M181T probably benign Het
Nxf7 A T X: 135,584,383 C495S possibly damaging Het
Oas1g T C 5: 120,887,529 T12A probably benign Het
Olfr130 C G 17: 38,067,671 R167G possibly damaging Het
Olfr23 T A 11: 73,941,053 V269E probably benign Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Olfr591 A T 7: 103,173,283 V118E possibly damaging Het
Olfr744 T A 14: 50,618,579 L119Q probably damaging Het
Papln C T 12: 83,783,379 Q1008* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Phf2 T A 13: 48,804,489 E1016D unknown Het
Phf8 T A X: 151,552,622 D197E probably benign Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Prpf4 A G 4: 62,422,605 Y419C probably damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Prr5 T A 15: 84,702,951 S301T probably benign Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Radil A G 5: 142,543,471 F186L probably damaging Het
Reg3g A T 6: 78,468,561 M1K probably null Het
Rps6ka3 A G X: 159,317,967 Y76C probably damaging Het
Rtl1 C T 12: 109,590,363 V1681I possibly damaging Het
Sfmbt1 C T 14: 30,811,507 R614C probably damaging Het
Slc12a4 A G 8: 105,951,967 S244P probably benign Het
Sptbn1 T C 11: 30,139,250 T671A possibly damaging Het
Supt16 A T 14: 52,174,113 N604K probably damaging Het
Synj2 G A 17: 6,029,783 V1096I probably benign Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tbc1d25 T C X: 8,172,869 Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 D709G probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tgfbi C A 13: 56,629,702 T333N probably benign Het
Tnk1 T C 11: 69,855,682 Y235C probably damaging Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Usp17le C A 7: 104,768,460 A492S probably damaging Het
Vmn1r213 A T 13: 23,011,762 M172L probably benign Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r19 A T 6: 123,335,986 I672F possibly damaging Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Xdh T A 17: 73,898,362 H1036L probably damaging Het
Zfp930 T A 8: 69,228,296 Y214* probably null Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGACCCTCACATCTGTCTGCAAAG -3'
(R):5'- TGCGCCTCAGAAGGATGACAAG -3'

Sequencing Primer
(F):5'- TGTCTGCAAAGGGGCTATAGAAC -3'
(R):5'- CCTCAGAAGGATGACAAGGTTTC -3'
Posted On2013-04-24