Incidental Mutation 'R4151:Atxn7l1'
ID314914
Institutional Source Beutler Lab
Gene Symbol Atxn7l1
Ensembl Gene ENSMUSG00000020564
Gene Nameataxin 7-like 1
SynonymsAtxn7l4, 2810423G08Rik
MMRRC Submission 040861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R4151 (G1)
Quality Score200
Status Not validated
Chromosome12
Chromosomal Location33147693-33373185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33364482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 506 (V506M)
Ref Sequence ENSEMBL: ENSMUSP00000122156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090597] [ENSMUST00000125192] [ENSMUST00000146040] [ENSMUST00000154742]
Predicted Effect probably benign
Transcript: ENSMUST00000090597
SMART Domains Protein: ENSMUSP00000088085
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 143 220 2.5e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125192
SMART Domains Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 567 597 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 792 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142184
SMART Domains Protein: ENSMUSP00000116081
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 25 44 N/A INTRINSIC
low complexity region 110 128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146040
AA Change: V506M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564
AA Change: V506M

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2.3e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 578 590 N/A INTRINSIC
low complexity region 669 699 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 894 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154742
SMART Domains Protein: ENSMUSP00000122982
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 150 218 1.3e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,836,254 S695R possibly damaging Het
Ano10 C T 9: 122,261,535 W237* probably null Het
Armc9 C T 1: 86,164,775 T87M probably damaging Het
Astn2 C T 4: 65,729,320 probably null Het
Cenpe A G 3: 135,215,153 N36D probably benign Het
Cfap45 T A 1: 172,532,221 I96N probably damaging Het
Cyp8b1 A T 9: 121,916,068 V66D probably damaging Het
Dnajb6 C G 5: 29,756,236 L118V probably benign Het
Dpy19l4 A G 4: 11,309,485 S44P possibly damaging Het
Dync2li1 A G 17: 84,628,335 H20R probably benign Het
Eif3g T C 9: 20,895,133 D220G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Gata2 T A 6: 88,199,638 H26Q probably damaging Het
Gle1 T C 2: 29,944,044 I434T probably damaging Het
Gm5145 A G 17: 20,571,098 E246G probably damaging Het
Ints10 T A 8: 68,794,598 probably null Het
Kdr G T 5: 75,957,101 A664E possibly damaging Het
Klhl1 A C 14: 96,518,316 M1R probably null Het
Lama4 T A 10: 39,005,428 F71Y probably benign Het
Madd C A 2: 91,143,083 R1410L probably benign Het
Magi2 T C 5: 19,227,292 S2P probably damaging Het
Map4k3 T C 17: 80,644,534 K228R probably damaging Het
Mrpl43 A G 19: 45,005,736 L148P possibly damaging Het
Msi2 G C 11: 88,718,044 S16C probably damaging Het
Myo1e G T 9: 70,297,351 G78* probably null Het
Notch2 T C 3: 98,147,071 L2350S possibly damaging Het
Nptn G T 9: 58,643,542 S168I probably benign Het
Nsmce2 A G 15: 59,601,365 T244A probably benign Het
Olfr1109 C T 2: 87,093,170 V76I probably benign Het
Ostn T A 16: 27,321,402 S22T probably benign Het
Plekhb2 T G 1: 34,864,483 F102V probably benign Het
Prkdc A G 16: 15,816,773 D3594G probably benign Het
Psmd6 G C 14: 14,120,157 L61V probably benign Het
Rbm33 C T 5: 28,387,940 P573S probably damaging Het
Rfk A C 19: 17,395,308 I65L probably benign Het
Rnf141 A T 7: 110,837,199 D7E probably benign Het
Shank2 A T 7: 144,054,828 K153M probably damaging Het
Slc30a2 A T 4: 134,344,048 I31F probably benign Het
Slco3a1 G T 7: 74,359,838 A243E probably damaging Het
Stab2 G A 10: 87,002,983 T73I probably benign Het
Sufu G A 19: 46,449,972 probably null Het
Sync C T 4: 129,293,726 Q184* probably null Het
Tnfrsf25 G T 4: 152,119,801 A376S probably damaging Het
Tnpo1 A T 13: 98,852,899 I765N probably damaging Het
Ube2d2b A T 5: 107,830,881 K133* probably null Het
Ulk3 C T 9: 57,592,367 S217L possibly damaging Het
Upf2 C A 2: 5,961,705 Q379K unknown Het
Vegfc T A 8: 54,077,789 L4Q unknown Het
Vmn2r104 A T 17: 20,029,885 I708N probably damaging Het
Other mutations in Atxn7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Atxn7l1 APN 12 33342142 missense probably damaging 1.00
IGL02146:Atxn7l1 APN 12 33368031 missense probably benign
IGL02202:Atxn7l1 APN 12 33342078 missense probably benign 0.05
IGL02804:Atxn7l1 APN 12 33367789 missense probably damaging 1.00
IGL03344:Atxn7l1 APN 12 33326066 missense probably damaging 1.00
R0270:Atxn7l1 UTSW 12 33342151 missense possibly damaging 0.58
R0621:Atxn7l1 UTSW 12 33326100 missense probably benign 0.15
R1840:Atxn7l1 UTSW 12 33371033 unclassified probably null
R1856:Atxn7l1 UTSW 12 33358770 missense probably damaging 1.00
R1992:Atxn7l1 UTSW 12 33358744 missense probably damaging 1.00
R1993:Atxn7l1 UTSW 12 33345977 missense probably benign
R2249:Atxn7l1 UTSW 12 33358840 missense probably damaging 1.00
R2369:Atxn7l1 UTSW 12 33358850 critical splice donor site probably null
R3695:Atxn7l1 UTSW 12 33358697 missense probably damaging 1.00
R3856:Atxn7l1 UTSW 12 33367600 missense probably damaging 1.00
R3976:Atxn7l1 UTSW 12 33325955 missense probably damaging 1.00
R4301:Atxn7l1 UTSW 12 33367238 missense probably damaging 1.00
R4305:Atxn7l1 UTSW 12 33341992 missense probably damaging 0.99
R4411:Atxn7l1 UTSW 12 33194887 intron probably benign
R4763:Atxn7l1 UTSW 12 33358878 intron probably benign
R5049:Atxn7l1 UTSW 12 33358687 missense probably benign 0.00
R5090:Atxn7l1 UTSW 12 33326078 missense probably damaging 1.00
R5134:Atxn7l1 UTSW 12 33372876 missense probably damaging 1.00
R5425:Atxn7l1 UTSW 12 33367120 missense probably damaging 1.00
R6161:Atxn7l1 UTSW 12 33358663 missense possibly damaging 0.62
R6813:Atxn7l1 UTSW 12 33367124 missense probably damaging 0.96
R7248:Atxn7l1 UTSW 12 33367195 missense probably benign 0.26
R7328:Atxn7l1 UTSW 12 33148503 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATAGAGGTGTTCGTCCCTGG -3'
(R):5'- CTGAAAGAGAATACTGTGTTGGCG -3'

Sequencing Primer
(F):5'- GCACGTGGAAGGAATGTGTTGATC -3'
(R):5'- CGTCTCCTGATGCAGAGTTAAATGC -3'
Posted On2015-05-14