Incidental Mutation 'R4151:Rfk'
ID314927
Institutional Source Beutler Lab
Gene Symbol Rfk
Ensembl Gene ENSMUSG00000024712
Gene Nameriboflavin kinase
Synonymsflavokinase, 0610038L10Rik, ATP:riboflavin 5'-phosphotransferase
MMRRC Submission 040861-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4151 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location17394043-17401349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 17395308 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 65 (I65L)
Ref Sequence ENSEMBL: ENSMUSP00000025617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025617]
Predicted Effect probably benign
Transcript: ENSMUST00000025617
AA Change: I65L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025617
Gene: ENSMUSG00000024712
AA Change: I65L

DomainStartEndE-ValueType
Flavokinase 1 131 5.68e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146171
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Riboflavin kinase (RFK; EC 2.7.1.26) is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis (Karthikeyan et al., 2003 [PubMed 12623014]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele die in utero prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,836,254 S695R possibly damaging Het
Ano10 C T 9: 122,261,535 W237* probably null Het
Armc9 C T 1: 86,164,775 T87M probably damaging Het
Astn2 C T 4: 65,729,320 probably null Het
Atxn7l1 G A 12: 33,364,482 V506M probably damaging Het
Cenpe A G 3: 135,215,153 N36D probably benign Het
Cfap45 T A 1: 172,532,221 I96N probably damaging Het
Cyp8b1 A T 9: 121,916,068 V66D probably damaging Het
Dnajb6 C G 5: 29,756,236 L118V probably benign Het
Dpy19l4 A G 4: 11,309,485 S44P possibly damaging Het
Dync2li1 A G 17: 84,628,335 H20R probably benign Het
Eif3g T C 9: 20,895,133 D220G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Gata2 T A 6: 88,199,638 H26Q probably damaging Het
Gle1 T C 2: 29,944,044 I434T probably damaging Het
Gm5145 A G 17: 20,571,098 E246G probably damaging Het
Ints10 T A 8: 68,794,598 probably null Het
Kdr G T 5: 75,957,101 A664E possibly damaging Het
Klhl1 A C 14: 96,518,316 M1R probably null Het
Lama4 T A 10: 39,005,428 F71Y probably benign Het
Madd C A 2: 91,143,083 R1410L probably benign Het
Magi2 T C 5: 19,227,292 S2P probably damaging Het
Map4k3 T C 17: 80,644,534 K228R probably damaging Het
Mrpl43 A G 19: 45,005,736 L148P possibly damaging Het
Msi2 G C 11: 88,718,044 S16C probably damaging Het
Myo1e G T 9: 70,297,351 G78* probably null Het
Notch2 T C 3: 98,147,071 L2350S possibly damaging Het
Nptn G T 9: 58,643,542 S168I probably benign Het
Nsmce2 A G 15: 59,601,365 T244A probably benign Het
Olfr1109 C T 2: 87,093,170 V76I probably benign Het
Ostn T A 16: 27,321,402 S22T probably benign Het
Plekhb2 T G 1: 34,864,483 F102V probably benign Het
Prkdc A G 16: 15,816,773 D3594G probably benign Het
Psmd6 G C 14: 14,120,157 L61V probably benign Het
Rbm33 C T 5: 28,387,940 P573S probably damaging Het
Rnf141 A T 7: 110,837,199 D7E probably benign Het
Shank2 A T 7: 144,054,828 K153M probably damaging Het
Slc30a2 A T 4: 134,344,048 I31F probably benign Het
Slco3a1 G T 7: 74,359,838 A243E probably damaging Het
Stab2 G A 10: 87,002,983 T73I probably benign Het
Sufu G A 19: 46,449,972 probably null Het
Sync C T 4: 129,293,726 Q184* probably null Het
Tnfrsf25 G T 4: 152,119,801 A376S probably damaging Het
Tnpo1 A T 13: 98,852,899 I765N probably damaging Het
Ube2d2b A T 5: 107,830,881 K133* probably null Het
Ulk3 C T 9: 57,592,367 S217L possibly damaging Het
Upf2 C A 2: 5,961,705 Q379K unknown Het
Vegfc T A 8: 54,077,789 L4Q unknown Het
Vmn2r104 A T 17: 20,029,885 I708N probably damaging Het
Other mutations in Rfk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Rfk APN 19 17395336 missense probably benign
IGL03124:Rfk APN 19 17398595 missense possibly damaging 0.53
PIT4544001:Rfk UTSW 19 17395344 missense probably damaging 1.00
R1193:Rfk UTSW 19 17395321 missense probably damaging 0.99
R2360:Rfk UTSW 19 17398596 missense probably benign 0.01
R3692:Rfk UTSW 19 17399470 splice site probably null
R4428:Rfk UTSW 19 17398595 missense possibly damaging 0.53
R5072:Rfk UTSW 19 17398599 missense possibly damaging 0.79
R5121:Rfk UTSW 19 17399566 missense probably damaging 1.00
R5469:Rfk UTSW 19 17395202 missense probably damaging 1.00
R5715:Rfk UTSW 19 17398638 missense probably benign 0.00
R5851:Rfk UTSW 19 17395198 missense probably damaging 1.00
R6050:Rfk UTSW 19 17399532 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCTGGGAGTGTAATGATTCAAG -3'
(R):5'- AGGAATGTCAGTTAGCATACAGC -3'

Sequencing Primer
(F):5'- TGGGAGTGTAATGATTCAAGTTAACG -3'
(R):5'- AATTACGATCTCTCTAGTAGTCCTGG -3'
Posted On2015-05-14