Incidental Mutation 'R4152:Ndst3'
ID314939
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 040996-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R4152 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123672227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 32 (Y32C)
Ref Sequence ENSEMBL: ENSMUSP00000118796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably damaging
Transcript: ENSMUST00000029602
AA Change: Y32C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137404
AA Change: Y32C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154668
AA Change: Y32C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172537
AA Change: Y32C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,897 H2036Q possibly damaging Het
Acaca T G 11: 84,292,926 M31R possibly damaging Het
Akap6 A C 12: 53,140,407 S1535R probably benign Het
Ap3b2 A G 7: 81,478,017 I137T probably damaging Het
Cdc16 A G 8: 13,762,857 S36G probably damaging Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Col4a1 T C 8: 11,217,227 probably null Het
Crem G T 18: 3,288,055 N179K probably damaging Het
Fam78b T C 1: 167,078,800 M176T probably benign Het
Gcn1l1 A G 5: 115,613,354 probably null Het
Gm6483 T C 8: 19,687,910 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klk1b16 T C 7: 44,140,549 F81S probably benign Het
Lpgat1 C A 1: 191,719,488 Y36* probably null Het
Mavs A G 2: 131,246,608 D444G probably benign Het
Nemp2 A G 1: 52,641,051 S145G probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr835 T A 9: 19,035,520 Y132* probably null Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pds5a A T 5: 65,666,171 C92* probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Phf3 C T 1: 30,831,458 V116I probably benign Het
Prl8a2 T C 13: 27,351,002 Y86H possibly damaging Het
Rab4b T C 7: 27,176,126 probably benign Het
Rsad1 T C 11: 94,548,623 probably benign Het
Sim1 G A 10: 50,983,854 C604Y probably damaging Het
Slc5a3 T A 16: 92,077,808 L251* probably null Het
Slit3 A G 11: 35,698,320 N1234S probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Snx31 T C 15: 36,525,639 N305D probably benign Het
St14 T C 9: 31,090,506 I768V probably benign Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Tlr6 A C 5: 64,953,212 F784C probably damaging Het
Tmem132a A G 19: 10,859,063 V701A probably benign Het
Tspan15 A T 10: 62,189,842 M197K possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r18 T A 5: 151,562,265 Q588L probably damaging Het
Vmn2r66 T C 7: 85,005,592 D503G probably benign Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCAAGGGATGAGTACTGGC -3'
(R):5'- CCAGATATGCTGCAATGGTGAC -3'

Sequencing Primer
(F):5'- AAGGGATGAGTACTGGCTCTCC -3'
(R):5'- CTGTTGACTGAGACTAGGAGC -3'
Posted On2015-05-14