Incidental Mutation 'R4152:9530053A07Rik'
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
MMRRC Submission 040996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4152 (G1)
Quality Score225
Status Validated
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28156897 bp
Amino Acid Change Histidine to Glutamine at position 2036 (H2036Q)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059886
AA Change: H2036Q

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: H2036Q

low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150948
AA Change: H2036Q

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: H2036Q

low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Meta Mutation Damage Score 0.1832 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,292,926 M31R possibly damaging Het
Akap6 A C 12: 53,140,407 S1535R probably benign Het
Ap3b2 A G 7: 81,478,017 I137T probably damaging Het
Cdc16 A G 8: 13,762,857 S36G probably damaging Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Col4a1 T C 8: 11,217,227 probably null Het
Crem G T 18: 3,288,055 N179K probably damaging Het
Fam78b T C 1: 167,078,800 M176T probably benign Het
Gcn1l1 A G 5: 115,613,354 probably null Het
Gm6483 T C 8: 19,687,910 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klk1b16 T C 7: 44,140,549 F81S probably benign Het
Lpgat1 C A 1: 191,719,488 Y36* probably null Het
Mavs A G 2: 131,246,608 D444G probably benign Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nemp2 A G 1: 52,641,051 S145G probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr835 T A 9: 19,035,520 Y132* probably null Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pds5a A T 5: 65,666,171 C92* probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Phf3 C T 1: 30,831,458 V116I probably benign Het
Prl8a2 T C 13: 27,351,002 Y86H possibly damaging Het
Rab4b T C 7: 27,176,126 probably benign Het
Rsad1 T C 11: 94,548,623 probably benign Het
Sim1 G A 10: 50,983,854 C604Y probably damaging Het
Slc5a3 T A 16: 92,077,808 L251* probably null Het
Slit3 A G 11: 35,698,320 N1234S probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Snx31 T C 15: 36,525,639 N305D probably benign Het
St14 T C 9: 31,090,506 I768V probably benign Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Tlr6 A C 5: 64,953,212 F784C probably damaging Het
Tmem132a A G 19: 10,859,063 V701A probably benign Het
Tspan15 A T 10: 62,189,842 M197K possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r18 T A 5: 151,562,265 Q588L probably damaging Het
Vmn2r66 T C 7: 85,005,592 D503G probably benign Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-14