Incidental Mutation 'R4153:Ndst3'
ID314980
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 040997-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R4153 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123672227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 32 (Y32C)
Ref Sequence ENSEMBL: ENSMUSP00000118796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably damaging
Transcript: ENSMUST00000029602
AA Change: Y32C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137404
AA Change: Y32C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154668
AA Change: Y32C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172537
AA Change: Y32C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,193,173 V47A probably benign Het
4932414N04Rik A T 2: 68,668,597 probably benign Het
Acat2 T A 17: 12,952,266 H159L possibly damaging Het
Acsl5 A G 19: 55,281,463 E253G probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ebf2 T G 14: 67,235,223 V30G probably damaging Het
Erlin1 T A 19: 44,067,617 T60S probably benign Het
Fanca A G 8: 123,304,878 V358A possibly damaging Het
Fastkd3 T C 13: 68,590,138 F602S probably damaging Het
Fras1 C A 5: 96,776,735 N3678K probably benign Het
Gm5346 T A 8: 43,626,527 Y220F probably benign Het
Gopc T C 10: 52,349,143 I277V probably damaging Het
Gpd2 A G 2: 57,355,771 T438A probably damaging Het
Gzma T C 13: 113,096,268 K97E possibly damaging Het
Gzmn T A 14: 56,167,842 T62S probably damaging Het
Hip1 T C 5: 135,412,706 E570G probably damaging Het
Hs3st6 T C 17: 24,758,365 V273A possibly damaging Het
Jarid2 C A 13: 44,910,426 S873R probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mast2 T C 4: 116,315,963 N548S possibly damaging Het
Mthfr G T 4: 148,051,475 R335L probably damaging Het
Nwd1 T C 8: 72,681,936 L808P probably damaging Het
Olfr681 A T 7: 105,122,309 H284L probably damaging Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pigk G A 3: 152,740,129 V126I probably damaging Het
Plcl2 A T 17: 50,606,361 K133* probably null Het
Pofut2 A G 10: 77,268,666 K426E probably benign Het
Rbpj T A 5: 53,649,447 H230Q probably damaging Het
Rnf213 A G 11: 119,409,482 K269E probably benign Het
Shh A T 5: 28,457,949 I407N probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Svep1 A T 4: 58,089,426 F1661Y possibly damaging Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Thrap3 A C 4: 126,173,442 probably null Het
Thumpd1 C T 7: 119,720,593 C50Y probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnrc18 T C 5: 142,765,992 D1368G possibly damaging Het
Tubd1 G A 11: 86,549,470 G107S probably damaging Het
Ugt1a6a A G 1: 88,138,471 probably null Het
Uty A G Y: 1,158,327 V572A possibly damaging Het
Vmn1r171 A G 7: 23,632,652 K89E probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r106 A G 17: 20,267,818 L773P probably damaging Het
Vps13b T A 15: 35,792,027 probably null Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGGAACCGGATGGATTCTAG -3'
(R):5'- TAGGAGCGTGCCTGAAACTC -3'

Sequencing Primer
(F):5'- CCGGATGGATTCTAGCATCATAATG -3'
(R):5'- GCGTGCCTGAAACTCCATCC -3'
Posted On2015-05-14