Incidental Mutation 'R4153:Mast2'
ID314982
Institutional Source Beutler Lab
Gene Symbol Mast2
Ensembl Gene ENSMUSG00000003810
Gene Namemicrotubule associated serine/threonine kinase 2
SynonymsMAST205, Mtssk
MMRRC Submission 040997-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4153 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116306762-116464183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116315963 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 548 (N548S)
Ref Sequence ENSEMBL: ENSMUSP00000102094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003908] [ENSMUST00000106484] [ENSMUST00000106485] [ENSMUST00000106486]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003908
AA Change: N487S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003908
Gene: ENSMUSG00000003810
AA Change: N487S

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 416 1.8e-148 PFAM
S_TKc 452 725 2.96e-99 SMART
S_TK_X 726 786 1.08e-1 SMART
low complexity region 849 861 N/A INTRINSIC
low complexity region 1009 1028 N/A INTRINSIC
PDZ 1049 1129 2.23e-12 SMART
low complexity region 1142 1157 N/A INTRINSIC
low complexity region 1177 1210 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
low complexity region 1279 1302 N/A INTRINSIC
low complexity region 1345 1360 N/A INTRINSIC
low complexity region 1437 1452 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106484
AA Change: N494S

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102093
Gene: ENSMUSG00000003810
AA Change: N494S

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 423 1.3e-151 PFAM
S_TKc 459 732 2.96e-99 SMART
S_TK_X 733 793 1.08e-1 SMART
low complexity region 856 868 N/A INTRINSIC
low complexity region 1016 1035 N/A INTRINSIC
PDZ 1056 1136 2.23e-12 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1184 1217 N/A INTRINSIC
low complexity region 1233 1255 N/A INTRINSIC
low complexity region 1285 1308 N/A INTRINSIC
low complexity region 1351 1366 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106485
AA Change: N548S

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102094
Gene: ENSMUSG00000003810
AA Change: N548S

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 477 1.1e-148 PFAM
S_TKc 513 786 2.96e-99 SMART
S_TK_X 787 847 1.08e-1 SMART
low complexity region 910 922 N/A INTRINSIC
low complexity region 1070 1089 N/A INTRINSIC
PDZ 1110 1190 2.23e-12 SMART
low complexity region 1203 1218 N/A INTRINSIC
low complexity region 1238 1271 N/A INTRINSIC
low complexity region 1285 1310 N/A INTRINSIC
low complexity region 1340 1363 N/A INTRINSIC
low complexity region 1406 1421 N/A INTRINSIC
low complexity region 1498 1513 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106486
AA Change: N555S

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102095
Gene: ENSMUSG00000003810
AA Change: N555S

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 483 2.9e-143 PFAM
S_TKc 520 793 2.96e-99 SMART
S_TK_X 794 854 1.08e-1 SMART
low complexity region 917 929 N/A INTRINSIC
low complexity region 1077 1096 N/A INTRINSIC
PDZ 1117 1197 2.23e-12 SMART
low complexity region 1210 1225 N/A INTRINSIC
low complexity region 1245 1278 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1346 1369 N/A INTRINSIC
low complexity region 1412 1427 N/A INTRINSIC
low complexity region 1504 1519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156884
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: No phenotype has been reported for a gene trap strain; however, it is not yet known whether the gene trap insertion affects expression of the gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,193,173 V47A probably benign Het
4932414N04Rik A T 2: 68,668,597 probably benign Het
Acat2 T A 17: 12,952,266 H159L possibly damaging Het
Acsl5 A G 19: 55,281,463 E253G probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ebf2 T G 14: 67,235,223 V30G probably damaging Het
Erlin1 T A 19: 44,067,617 T60S probably benign Het
Fanca A G 8: 123,304,878 V358A possibly damaging Het
Fastkd3 T C 13: 68,590,138 F602S probably damaging Het
Fras1 C A 5: 96,776,735 N3678K probably benign Het
Gm5346 T A 8: 43,626,527 Y220F probably benign Het
Gopc T C 10: 52,349,143 I277V probably damaging Het
Gpd2 A G 2: 57,355,771 T438A probably damaging Het
Gzma T C 13: 113,096,268 K97E possibly damaging Het
Gzmn T A 14: 56,167,842 T62S probably damaging Het
Hip1 T C 5: 135,412,706 E570G probably damaging Het
Hs3st6 T C 17: 24,758,365 V273A possibly damaging Het
Jarid2 C A 13: 44,910,426 S873R probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mthfr G T 4: 148,051,475 R335L probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nwd1 T C 8: 72,681,936 L808P probably damaging Het
Olfr681 A T 7: 105,122,309 H284L probably damaging Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pigk G A 3: 152,740,129 V126I probably damaging Het
Plcl2 A T 17: 50,606,361 K133* probably null Het
Pofut2 A G 10: 77,268,666 K426E probably benign Het
Rbpj T A 5: 53,649,447 H230Q probably damaging Het
Rnf213 A G 11: 119,409,482 K269E probably benign Het
Shh A T 5: 28,457,949 I407N probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Svep1 A T 4: 58,089,426 F1661Y possibly damaging Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Thrap3 A C 4: 126,173,442 probably null Het
Thumpd1 C T 7: 119,720,593 C50Y probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnrc18 T C 5: 142,765,992 D1368G possibly damaging Het
Tubd1 G A 11: 86,549,470 G107S probably damaging Het
Ugt1a6a A G 1: 88,138,471 probably null Het
Uty A G Y: 1,158,327 V572A possibly damaging Het
Vmn1r171 A G 7: 23,632,652 K89E probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r106 A G 17: 20,267,818 L773P probably damaging Het
Vps13b T A 15: 35,792,027 probably null Het
Other mutations in Mast2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Mast2 APN 4 116311329 missense probably benign 0.39
IGL00916:Mast2 APN 4 116327633 missense possibly damaging 0.88
IGL02112:Mast2 APN 4 116319764 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116307987 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116312846 splice site probably benign
R0883:Mast2 UTSW 4 116311767 missense probably damaging 1.00
R1447:Mast2 UTSW 4 116312013 missense probably benign 0.02
R1449:Mast2 UTSW 4 116309013 missense probably damaging 1.00
R1473:Mast2 UTSW 4 116311955 missense probably damaging 1.00
R1491:Mast2 UTSW 4 116316491 missense possibly damaging 0.90
R1529:Mast2 UTSW 4 116430519 missense probably benign 0.17
R1654:Mast2 UTSW 4 116316550 critical splice acceptor site probably null
R1768:Mast2 UTSW 4 116306959 missense probably damaging 1.00
R1807:Mast2 UTSW 4 116310741 splice site probably benign
R1981:Mast2 UTSW 4 116314840 missense probably damaging 1.00
R2081:Mast2 UTSW 4 116330474 splice site probably null
R2157:Mast2 UTSW 4 116322283 missense probably damaging 1.00
R3409:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3411:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3434:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3435:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3953:Mast2 UTSW 4 116313729 missense probably damaging 1.00
R4056:Mast2 UTSW 4 116337501 splice site probably benign
R4648:Mast2 UTSW 4 116314839 nonsense probably null
R4671:Mast2 UTSW 4 116308650 missense probably damaging 1.00
R4911:Mast2 UTSW 4 116353057 missense probably benign 0.36
R4980:Mast2 UTSW 4 116317751 missense probably damaging 1.00
R5322:Mast2 UTSW 4 116333411 critical splice donor site probably null
R5462:Mast2 UTSW 4 116307458 missense probably damaging 0.99
R5586:Mast2 UTSW 4 116435563 missense probably damaging 0.99
R5750:Mast2 UTSW 4 116308889 intron probably benign
R5771:Mast2 UTSW 4 116333425 missense possibly damaging 0.60
R5885:Mast2 UTSW 4 116314838 missense probably damaging 1.00
R6230:Mast2 UTSW 4 116326098 missense probably damaging 1.00
R6347:Mast2 UTSW 4 116317732 missense probably damaging 1.00
R6527:Mast2 UTSW 4 116314939 missense probably damaging 0.99
R6619:Mast2 UTSW 4 116316497 nonsense probably null
R7070:Mast2 UTSW 4 116310855 missense probably benign 0.03
R7303:Mast2 UTSW 4 116308311 missense possibly damaging 0.63
X0003:Mast2 UTSW 4 116307647 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTCTCAGACTGCACTTTGAC -3'
(R):5'- TCATTGGCACAGTAGCAGG -3'

Sequencing Primer
(F):5'- GACTGCACTTTGACTTCTATATAGC -3'
(R):5'- AGGCACACCCCAAGGTCTTTG -3'
Posted On2015-05-14