Incidental Mutation 'R4154:Asph'
ID315033
Institutional Source Beutler Lab
Gene Symbol Asph
Ensembl Gene ENSMUSG00000028207
Gene Nameaspartate-beta-hydroxylase
Synonymsaspartyl beta-hydroxylase, BAH, calsequestrin-binding protein, jumbug, 2310005F16Rik, 3110001L23Rik, junctate, cI-37, Junctin
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location9448069-9669344 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 9639250 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 38 (W38*)
Ref Sequence ENSEMBL: ENSMUSP00000116874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038564] [ENSMUST00000078139] [ENSMUST00000084912] [ENSMUST00000084915] [ENSMUST00000098275] [ENSMUST00000103004] [ENSMUST00000108333] [ENSMUST00000108334] [ENSMUST00000108335] [ENSMUST00000108337] [ENSMUST00000108339] [ENSMUST00000108340] [ENSMUST00000131605] [ENSMUST00000146441] [ENSMUST00000152526]
Predicted Effect probably null
Transcript: ENSMUST00000038564
AA Change: W76*
SMART Domains Protein: ENSMUSP00000049018
Gene: ENSMUSG00000028207
AA Change: W76*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 244 1.6e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078139
AA Change: W76*
SMART Domains Protein: ENSMUSP00000077273
Gene: ENSMUSG00000028207
AA Change: W76*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 7e-104 PFAM
Pfam:TPR_6 326 357 4.4e-5 PFAM
Pfam:TPR_16 328 398 1.3e-9 PFAM
Pfam:TPR_2 439 470 2.6e-4 PFAM
Pfam:TPR_8 441 470 1.7e-3 PFAM
Pfam:Asp_Arg_Hydrox 574 728 7.6e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084912
AA Change: W76*
SMART Domains Protein: ENSMUSP00000081975
Gene: ENSMUSG00000028207
AA Change: W76*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 163 1.5e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084915
AA Change: W76*
SMART Domains Protein: ENSMUSP00000081978
Gene: ENSMUSG00000028207
AA Change: W76*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 6.2e-105 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098275
AA Change: W76*
SMART Domains Protein: ENSMUSP00000095876
Gene: ENSMUSG00000028207
AA Change: W76*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 188 5.6e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103004
AA Change: W38*
SMART Domains Protein: ENSMUSP00000100069
Gene: ENSMUSG00000028207
AA Change: W38*

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 81 5.2e-49 PFAM
Pfam:Asp-B-Hydro_N 78 206 1.1e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108333
AA Change: W38*
SMART Domains Protein: ENSMUSP00000103970
Gene: ENSMUSG00000028207
AA Change: W38*

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 128 5.8e-59 PFAM
Pfam:Asp-B-Hydro_N 121 258 8.8e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108334
AA Change: W38*
SMART Domains Protein: ENSMUSP00000103971
Gene: ENSMUSG00000028207
AA Change: W38*

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 269 3.8e-105 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108335
AA Change: W38*
SMART Domains Protein: ENSMUSP00000103972
Gene: ENSMUSG00000028207
AA Change: W38*

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 84 1.6e-49 PFAM
Pfam:Asp-B-Hydro_N 79 212 1.6e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108337
AA Change: W76*
SMART Domains Protein: ENSMUSP00000103974
Gene: ENSMUSG00000028207
AA Change: W76*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 1.8e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108339
AA Change: W9*
SMART Domains Protein: ENSMUSP00000103976
Gene: ENSMUSG00000028207
AA Change: W9*

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 224 1.6e-80 PFAM
Pfam:TPR_6 243 274 1.4e-4 PFAM
Pfam:TPR_16 245 315 2.5e-9 PFAM
Pfam:TPR_2 356 387 7e-4 PFAM
Pfam:Asp_Arg_Hydrox 489 646 5.3e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108340
AA Change: W76*
SMART Domains Protein: ENSMUSP00000103977
Gene: ENSMUSG00000028207
AA Change: W76*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 8.6e-96 PFAM
Pfam:TPR_6 310 341 1.9e-4 PFAM
Pfam:TPR_16 312 382 2.9e-9 PFAM
Pfam:TPR_2 423 454 6.8e-4 PFAM
Pfam:Asp_Arg_Hydrox 556 713 3.8e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131605
AA Change: W9*
SMART Domains Protein: ENSMUSP00000118518
Gene: ENSMUSG00000028207
AA Change: W9*

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 73 2.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137375
Predicted Effect probably null
Transcript: ENSMUST00000146441
AA Change: W76*
SMART Domains Protein: ENSMUSP00000116899
Gene: ENSMUSG00000028207
AA Change: W76*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 203 1.2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152058
Predicted Effect probably null
Transcript: ENSMUST00000152526
AA Change: W38*
SMART Domains Protein: ENSMUSP00000116874
Gene: ENSMUSG00000028207
AA Change: W38*

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 149 8.2e-70 PFAM
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a mutation lacking aspartyl beta-hydroxylase expression exhibit syndactyly, facial dysmorphology, mild hard palate defects, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Asph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Asph APN 4 9639322 missense probably damaging 1.00
IGL00928:Asph APN 4 9594675 missense probably benign 0.07
IGL01022:Asph APN 4 9601344 missense possibly damaging 0.63
IGL01677:Asph APN 4 9607853 missense probably damaging 1.00
IGL01907:Asph APN 4 9514643 missense possibly damaging 0.59
IGL01958:Asph APN 4 9474904 missense possibly damaging 0.93
IGL01976:Asph APN 4 9475471 missense probably damaging 0.98
IGL01989:Asph APN 4 9602462 splice site probably benign
IGL02379:Asph APN 4 9474980 missense probably damaging 1.00
IGL02444:Asph APN 4 9542319 splice site probably benign
IGL02652:Asph APN 4 9529984 missense probably benign 0.11
IGL02679:Asph APN 4 9601349 missense possibly damaging 0.63
IGL02735:Asph APN 4 9598759 missense probably damaging 1.00
IGL02875:Asph APN 4 9595380 missense probably damaging 1.00
IGL03022:Asph APN 4 9517668 missense possibly damaging 0.48
R0026:Asph UTSW 4 9601361 missense probably damaging 0.97
R0121:Asph UTSW 4 9635918 missense probably damaging 1.00
R0357:Asph UTSW 4 9453314 missense probably benign 0.01
R0410:Asph UTSW 4 9595415 missense probably damaging 1.00
R0554:Asph UTSW 4 9604581 missense probably damaging 0.99
R0577:Asph UTSW 4 9604620 missense probably benign 0.02
R0718:Asph UTSW 4 9514683 splice site probably benign
R0725:Asph UTSW 4 9542275 missense probably damaging 1.00
R1383:Asph UTSW 4 9537807 intron probably null
R1654:Asph UTSW 4 9453315 missense probably benign 0.31
R1694:Asph UTSW 4 9610869 missense probably damaging 0.99
R1771:Asph UTSW 4 9598773 missense probably damaging 0.99
R1776:Asph UTSW 4 9598773 missense probably damaging 0.99
R1840:Asph UTSW 4 9601340 missense possibly damaging 0.60
R1911:Asph UTSW 4 9453335 missense probably damaging 1.00
R1912:Asph UTSW 4 9453335 missense probably damaging 1.00
R2117:Asph UTSW 4 9517671 nonsense probably null
R2860:Asph UTSW 4 9598277 missense probably damaging 1.00
R2861:Asph UTSW 4 9598277 missense probably damaging 1.00
R2937:Asph UTSW 4 9542314 splice site probably benign
R3907:Asph UTSW 4 9474934 missense probably benign 0.23
R4623:Asph UTSW 4 9622005 missense possibly damaging 0.50
R4871:Asph UTSW 4 9531968 missense probably benign 0.02
R5196:Asph UTSW 4 9607830 missense probably damaging 0.99
R5540:Asph UTSW 4 9635906 missense probably damaging 1.00
R5757:Asph UTSW 4 9637722 intron probably null
R6063:Asph UTSW 4 9531960 missense probably benign 0.05
R6072:Asph UTSW 4 9643533 critical splice donor site probably null
R7133:Asph UTSW 4 9484575 missense probably benign 0.01
Z1088:Asph UTSW 4 9630715 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATTCAGGTCACTACTCTGGG -3'
(R):5'- AAGCTTCTCGTGTTCAGAGTC -3'

Sequencing Primer
(F):5'- TACTCTGGGGCAGCCCTTTG -3'
(R):5'- CAGAGTCATTAATTTATGGAGTGCAC -3'
Posted On2015-05-14