Incidental Mutation 'R0389:Myh2'
ID31504
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 038595-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R0389 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67180821 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 488 (L488P)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably damaging
Transcript: ENSMUST00000018641
AA Change: L488P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: L488P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170159
AA Change: L488P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: L488P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,671,404 E30K unknown Het
Abi3bp A T 16: 56,671,307 T1319S possibly damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Adgre1 G A 17: 57,406,839 D175N possibly damaging Het
Adgrf1 T C 17: 43,303,788 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Anks1 A G 17: 27,995,952 R458G possibly damaging Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1g C T 11: 94,459,697 V441M probably damaging Het
Cadps2 A T 6: 23,321,782 V1037E possibly damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cenpq T C 17: 40,933,194 probably benign Het
Chrac1 T C 15: 73,093,527 I93T possibly damaging Het
Cntnap2 T A 6: 46,009,637 S359T probably benign Het
Col6a6 C A 9: 105,784,204 M235I probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Cyp1a2 T C 9: 57,682,025 N169D probably benign Het
Dennd1c T A 17: 57,067,649 T499S probably benign Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Eif3h C A 15: 51,799,264 V129F probably damaging Het
Eno2 A G 6: 124,762,691 F380L probably damaging Het
Ergic2 T A 6: 148,183,202 I34F probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam185a C T 5: 21,459,285 T339M probably damaging Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Fam71f2 T A 6: 29,281,392 V43E possibly damaging Het
Fasn G T 11: 120,816,182 D881E probably damaging Het
Fat1 C A 8: 44,950,348 H45Q probably benign Het
Fbxw16 A T 9: 109,432,482 C439S probably benign Het
Gba2 A T 4: 43,570,832 F280Y probably damaging Het
Gfm1 A G 3: 67,457,918 I517V probably benign Het
Gng13 C T 17: 25,718,722 Q8* probably null Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gphn A T 12: 78,590,659 I381F probably damaging Het
Grm3 T C 5: 9,504,794 N833D probably damaging Het
Gstt2 G T 10: 75,832,432 T163K probably damaging Het
Gusb A T 5: 129,998,086 V388E probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hspg2 A G 4: 137,515,423 T650A possibly damaging Het
Ints2 C T 11: 86,248,851 V306I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Klhl18 A T 9: 110,428,681 C564S probably benign Het
Krt40 T A 11: 99,541,714 R159* probably null Het
L3mbtl4 G A 17: 68,455,780 V103M probably damaging Het
Lnx2 C A 5: 147,019,040 V649L possibly damaging Het
Lpp A T 16: 24,608,241 Q39H probably damaging Het
Lrpprc A T 17: 84,753,112 probably null Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Mbtps2 G T X: 157,568,368 T134K probably benign Het
Mfng C T 15: 78,764,437 V147M possibly damaging Het
Mks1 T C 11: 87,857,928 S273P probably benign Het
Myo15 A G 11: 60,478,538 N708S probably benign Het
Myo6 A T 9: 80,292,466 N1019I probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Ncoa1 T G 12: 4,295,976 N457T probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nlrp4e C A 7: 23,355,203 N927K probably damaging Het
Npffr2 T C 5: 89,582,754 M181T probably benign Het
Nxf7 A T X: 135,584,383 C495S possibly damaging Het
Oas1g T C 5: 120,887,529 T12A probably benign Het
Olfr130 C G 17: 38,067,671 R167G possibly damaging Het
Olfr23 T A 11: 73,941,053 V269E probably benign Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Olfr591 A T 7: 103,173,283 V118E possibly damaging Het
Olfr744 T A 14: 50,618,579 L119Q probably damaging Het
Papln C T 12: 83,783,379 Q1008* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Phf2 T A 13: 48,804,489 E1016D unknown Het
Phf8 T A X: 151,552,622 D197E probably benign Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Prpf4 A G 4: 62,422,605 Y419C probably damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Prr5 T A 15: 84,702,951 S301T probably benign Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Radil A G 5: 142,543,471 F186L probably damaging Het
Reg3g A T 6: 78,468,561 M1K probably null Het
Rps6ka3 A G X: 159,317,967 Y76C probably damaging Het
Rtl1 C T 12: 109,590,363 V1681I possibly damaging Het
Sfmbt1 C T 14: 30,811,507 R614C probably damaging Het
Slc12a4 A G 8: 105,951,967 S244P probably benign Het
Sptbn1 T C 11: 30,139,250 T671A possibly damaging Het
Supt16 A T 14: 52,174,113 N604K probably damaging Het
Synj2 G A 17: 6,029,783 V1096I probably benign Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tbc1d25 T C X: 8,172,869 Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 D709G probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tgfbi C A 13: 56,629,702 T333N probably benign Het
Tnk1 T C 11: 69,855,682 Y235C probably damaging Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Unc13a A G 8: 71,658,032 F464L probably benign Het
Usp17le C A 7: 104,768,460 A492S probably damaging Het
Vmn1r213 A T 13: 23,011,762 M172L probably benign Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r19 A T 6: 123,335,986 I672F possibly damaging Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Xdh T A 17: 73,898,362 H1036L probably damaging Het
Zfp930 T A 8: 69,228,296 Y214* probably null Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GGCGTCTACATGCCTCAAACCTTC -3'
(R):5'- AGGGAACATGCACTCCTCTTCCAG -3'

Sequencing Primer
(F):5'- TCTACATGCCTCAAACCTTCCATAC -3'
(R):5'- CCTCTTCCAGGATGGAGAAGATG -3'
Posted On2013-04-24