Incidental Mutation 'R4154:Clcn4'
ID 315041
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Name chloride channel, voltage-sensitive 4
Synonyms Clc4-2, Clcn4-2
MMRRC Submission 040998-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4154 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 7285308-7303837 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7297833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 67 (N67D)
Ref Sequence ENSEMBL: ENSMUSP00000147627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000210594] [ENSMUST00000211574]
AlphaFold Q61418
Predicted Effect probably benign
Transcript: ENSMUST00000000619
AA Change: N139D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: N139D

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176903
Predicted Effect probably benign
Transcript: ENSMUST00000209916
Predicted Effect probably benign
Transcript: ENSMUST00000210061
AA Change: N139D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210318
Predicted Effect probably benign
Transcript: ENSMUST00000210362
AA Change: N67D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210444
Predicted Effect probably benign
Transcript: ENSMUST00000210594
AA Change: N79D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210809
Predicted Effect probably benign
Transcript: ENSMUST00000211574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210989
Meta Mutation Damage Score 0.1598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,589,204 (GRCm39) H124Q probably benign Het
Asph C T 4: 9,639,250 (GRCm39) W38* probably null Het
Bicdl2 A G 17: 23,885,066 (GRCm39) probably null Het
Chd8 T C 14: 52,444,668 (GRCm39) probably benign Het
Cptp A G 4: 155,951,657 (GRCm39) V12A possibly damaging Het
Crim1 A G 17: 78,545,272 (GRCm39) I145V probably benign Het
Ctsc G A 7: 87,948,755 (GRCm39) M195I probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Fas T G 19: 34,296,228 (GRCm39) I180S possibly damaging Het
Fsip2 A C 2: 82,817,413 (GRCm39) E4382A possibly damaging Het
Galnt5 T G 2: 57,888,505 (GRCm39) L35R probably damaging Het
Gfpt2 G A 11: 49,726,605 (GRCm39) probably null Het
Gjd4 G T 18: 9,280,811 (GRCm39) S89* probably null Het
Gm14496 A T 2: 181,636,872 (GRCm39) H110L probably benign Het
Golm1 A G 13: 59,790,167 (GRCm39) V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,732,666 (GRCm39) probably benign Het
Ighv1-72 A T 12: 115,722,017 (GRCm39) M7K probably benign Het
Igkv12-44 C T 6: 69,791,639 (GRCm39) C108Y possibly damaging Het
Lum T C 10: 97,404,815 (GRCm39) S237P probably damaging Het
Macf1 T C 4: 123,365,606 (GRCm39) K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 (GRCm39) E1588G probably damaging Het
Ndst3 T C 3: 123,465,876 (GRCm39) Y32C probably damaging Het
Nucb2 A G 7: 116,126,902 (GRCm39) T172A probably benign Het
Or52b1 T C 7: 104,978,592 (GRCm39) N269S probably damaging Het
Pard3 G T 8: 128,200,877 (GRCm39) R978L probably damaging Het
Pcdha4 A G 18: 37,086,639 (GRCm39) probably null Het
Pgk2 A G 17: 40,519,149 (GRCm39) V93A probably damaging Het
Pik3c3 G A 18: 30,444,336 (GRCm39) M516I probably benign Het
Plxnb2 A G 15: 89,043,845 (GRCm39) F1336L probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 G C 12: 82,471,988 (GRCm39) G1323R possibly damaging Het
Sntg1 A T 1: 8,653,569 (GRCm39) probably null Het
Spef2 T C 15: 9,626,107 (GRCm39) K1153R probably benign Het
Strn3 C T 12: 51,673,914 (GRCm39) V566M probably damaging Het
Svep1 A G 4: 58,069,068 (GRCm39) F2906S possibly damaging Het
Tbc1d8 C T 1: 39,425,216 (GRCm39) V545M probably damaging Het
Tmem131 T C 1: 36,847,874 (GRCm39) probably benign Het
Tnfsf8 A G 4: 63,752,595 (GRCm39) S157P probably benign Het
Tubgcp5 G A 7: 55,455,077 (GRCm39) V258M probably benign Het
Vat1l G C 8: 114,932,543 (GRCm39) G30R possibly damaging Het
Vegfb T C 19: 6,963,446 (GRCm39) Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,743,681 (GRCm39) probably null Het
Zc3h15 T C 2: 83,488,913 (GRCm39) V161A probably benign Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7,290,672 (GRCm39) missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7,297,035 (GRCm39) missense probably benign 0.01
IGL01650:Clcn4 APN 7 7,287,280 (GRCm39) splice site probably benign
IGL02404:Clcn4 APN 7 7,290,857 (GRCm39) missense probably benign 0.04
IGL02493:Clcn4 APN 7 7,287,243 (GRCm39) missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7,299,065 (GRCm39) missense probably benign
IGL02661:Clcn4 APN 7 7,294,730 (GRCm39) splice site probably null
IGL02816:Clcn4 APN 7 7,298,087 (GRCm39) missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7,293,464 (GRCm39) missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7,293,419 (GRCm39) missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7,287,257 (GRCm39) missense probably damaging 1.00
Delipidated UTSW 7 7,296,060 (GRCm39) missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7,298,090 (GRCm39) nonsense probably null
R0379:Clcn4 UTSW 7 7,299,791 (GRCm39) missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7,293,503 (GRCm39) missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7,291,964 (GRCm39) missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7,299,763 (GRCm39) nonsense probably null
R1549:Clcn4 UTSW 7 7,294,681 (GRCm39) missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7,296,981 (GRCm39) missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7,287,184 (GRCm39) makesense probably null
R2764:Clcn4 UTSW 7 7,299,798 (GRCm39) missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7,293,520 (GRCm39) missense probably benign 0.33
R4023:Clcn4 UTSW 7 7,293,427 (GRCm39) missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7,293,427 (GRCm39) missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7,297,833 (GRCm39) missense probably benign 0.02
R4298:Clcn4 UTSW 7 7,299,737 (GRCm39) missense possibly damaging 0.93
R4535:Clcn4 UTSW 7 7,290,813 (GRCm39) missense probably benign 0.01
R4574:Clcn4 UTSW 7 7,290,804 (GRCm39) missense probably benign 0.23
R4977:Clcn4 UTSW 7 7,294,436 (GRCm39) missense probably benign 0.00
R5158:Clcn4 UTSW 7 7,294,618 (GRCm39) missense possibly damaging 0.94
R5302:Clcn4 UTSW 7 7,297,050 (GRCm39) missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7,299,032 (GRCm39) missense probably benign 0.26
R5624:Clcn4 UTSW 7 7,291,943 (GRCm39) missense probably benign 0.35
R5626:Clcn4 UTSW 7 7,292,017 (GRCm39) missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7,294,681 (GRCm39) missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7,294,481 (GRCm39) missense probably benign 0.00
R6259:Clcn4 UTSW 7 7,294,529 (GRCm39) missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7,297,024 (GRCm39) missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7,302,181 (GRCm39) unclassified probably benign
R7320:Clcn4 UTSW 7 7,294,827 (GRCm39) missense probably benign 0.19
R7562:Clcn4 UTSW 7 7,298,081 (GRCm39) missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7,296,958 (GRCm39) missense probably benign 0.00
R7752:Clcn4 UTSW 7 7,296,936 (GRCm39) missense probably benign
R7860:Clcn4 UTSW 7 7,296,060 (GRCm39) missense probably damaging 1.00
R7872:Clcn4 UTSW 7 7,290,780 (GRCm39) missense probably benign
R7895:Clcn4 UTSW 7 7,298,167 (GRCm39) missense probably benign 0.26
R8069:Clcn4 UTSW 7 7,299,758 (GRCm39) missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7,294,427 (GRCm39) missense possibly damaging 0.69
R9185:Clcn4 UTSW 7 7,287,197 (GRCm39) missense possibly damaging 0.74
R9281:Clcn4 UTSW 7 7,294,813 (GRCm39) missense probably benign 0.16
R9333:Clcn4 UTSW 7 7,292,192 (GRCm39) missense probably damaging 1.00
R9682:Clcn4 UTSW 7 7,299,797 (GRCm39) missense probably benign 0.02
X0019:Clcn4 UTSW 7 7,294,609 (GRCm39) missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7,297,755 (GRCm39) missense probably damaging 0.96
Z1177:Clcn4 UTSW 7 7,296,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGGTTTGTCTACCAGGC -3'
(R):5'- CACTTTTGAGGACAGGGACAAG -3'

Sequencing Primer
(F):5'- ACAGGGTTTGTCTACCAGGCTTATG -3'
(R):5'- GTCAGAGCTTCTTCTGAGCCAG -3'
Posted On 2015-05-14