Incidental Mutation 'R4155:Ica1l'
ID315068
Institutional Source Beutler Lab
Gene Symbol Ica1l
Ensembl Gene ENSMUSG00000026018
Gene Nameislet cell autoantigen 1-like
Synonyms1700030B17Rik, Als2cr15
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59982490-60043184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60013893 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 162 (A162V)
Ref Sequence ENSEMBL: ENSMUSP00000141103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027172] [ENSMUST00000189776] [ENSMUST00000191251]
Predicted Effect probably benign
Transcript: ENSMUST00000027172
AA Change: A162V

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027172
Gene: ENSMUSG00000026018
AA Change: A162V

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187364
Predicted Effect possibly damaging
Transcript: ENSMUST00000189776
AA Change: A162V

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141103
Gene: ENSMUSG00000026018
AA Change: A162V

DomainStartEndE-ValueType
Arfaptin 15 242 7.8e-117 SMART
ICA69 254 439 2.7e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191251
AA Change: A162V

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140520
Gene: ENSMUSG00000026018
AA Change: A162V

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit reduced male fertility with oligospermia, globospermia, and abnormal spermiogenesis, sperm nucleus and mitochondrial sheath morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ica1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Ica1l APN 1 60013947 missense probably damaging 1.00
IGL01526:Ica1l APN 1 60015757 missense probably damaging 0.99
IGL02538:Ica1l APN 1 60010186 missense probably benign 0.01
IGL02966:Ica1l APN 1 60010139 missense probably damaging 1.00
IGL03379:Ica1l APN 1 59997621 missense probably benign 0.07
PIT4466001:Ica1l UTSW 1 60015836 critical splice acceptor site probably null
R0278:Ica1l UTSW 1 60013996 missense probably benign 0.05
R0780:Ica1l UTSW 1 59997449 critical splice donor site probably null
R0926:Ica1l UTSW 1 60006297 missense probably benign 0.09
R1834:Ica1l UTSW 1 60028236 utr 5 prime probably benign
R2402:Ica1l UTSW 1 60006292 missense probably benign 0.00
R4545:Ica1l UTSW 1 60013818 critical splice donor site probably null
R4754:Ica1l UTSW 1 60028162 missense probably damaging 1.00
R4791:Ica1l UTSW 1 60010201 missense probably damaging 1.00
R5096:Ica1l UTSW 1 60028154 missense possibly damaging 0.92
R5217:Ica1l UTSW 1 60015758 missense probably benign 0.03
R5461:Ica1l UTSW 1 60013851 missense probably damaging 1.00
R5780:Ica1l UTSW 1 60028215 missense probably benign 0.04
R6557:Ica1l UTSW 1 59997625 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCTGCCGAAATATCCAAGCAAC -3'
(R):5'- AGCTCCACGATAAATACATGTTGCA -3'

Sequencing Primer
(F):5'- CTGGGCTATACAGTGAGATCCAATC -3'
(R):5'- CCACGATAAATACATGTTGCAATGTG -3'
Posted On2015-05-14