Incidental Mutation 'R4155:Akt3'
ID315072
Institutional Source Beutler Lab
Gene Symbol Akt3
Ensembl Gene ENSMUSG00000019699
Gene Namethymoma viral proto-oncogene 3
SynonymsD930002M15Rik, Nmf350, PKB gamma
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location177020073-177258203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 177096977 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 184 (I184T)
Ref Sequence ENSEMBL: ENSMUSP00000106790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019843] [ENSMUST00000111159] [ENSMUST00000111160]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019843
AA Change: I184T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019843
Gene: ENSMUSG00000019699
AA Change: I184T

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 467 6.37e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111159
AA Change: I184T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106789
Gene: ENSMUSG00000019699
AA Change: I184T

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111160
AA Change: I184T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106790
Gene: ENSMUSG00000019699
AA Change: I184T

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. Mice heterozygous for an ENU-induced mutation exhibit increased seizures (sporadic and induced) and increased brain weight and size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Akt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Akt3 APN 1 177130967 splice site probably benign
IGL02348:Akt3 APN 1 177059386 missense probably damaging 0.99
IGL02394:Akt3 APN 1 177059419 missense probably damaging 1.00
IGL03005:Akt3 APN 1 177067227 missense probably damaging 1.00
R0114:Akt3 UTSW 1 177067251 missense probably damaging 1.00
R1403:Akt3 UTSW 1 177131110 splice site probably benign
R1452:Akt3 UTSW 1 177131067 missense possibly damaging 0.93
R1495:Akt3 UTSW 1 177103042 missense probably benign
R1961:Akt3 UTSW 1 177096995 missense probably damaging 0.97
R2062:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2064:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2066:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2068:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R4937:Akt3 UTSW 1 177050127 missense possibly damaging 0.89
R5097:Akt3 UTSW 1 177248688 missense probably benign 0.01
R5414:Akt3 UTSW 1 177050251 missense probably damaging 0.98
R6336:Akt3 UTSW 1 177031712 missense probably damaging 1.00
R6723:Akt3 UTSW 1 177050190 nonsense probably null
R6752:Akt3 UTSW 1 177050190 nonsense probably null
R6753:Akt3 UTSW 1 177050190 nonsense probably null
R6755:Akt3 UTSW 1 177050190 nonsense probably null
R6765:Akt3 UTSW 1 177050190 nonsense probably null
R6766:Akt3 UTSW 1 177050190 nonsense probably null
R6767:Akt3 UTSW 1 177050190 nonsense probably null
R6782:Akt3 UTSW 1 177050190 nonsense probably null
R6787:Akt3 UTSW 1 177050190 nonsense probably null
R6847:Akt3 UTSW 1 177031659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACAAGAGAATAACAGTTTCACC -3'
(R):5'- GTAGGAACAGTATCAAGTGTATGGTGC -3'

Sequencing Primer
(F):5'- GGAATACCTATACCGCCAC -3'
(R):5'- TGGTGCAAGTTTATACAGCAAG -3'
Posted On2015-05-14