Incidental Mutation 'R4155:Uaca'
ID315093
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Nameuveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms2700059D02Rik, nucling
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location60794542-60880370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60871753 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1141 (S1141G)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
Predicted Effect probably benign
Transcript: ENSMUST00000050183
AA Change: S1141G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: S1141G

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214354
AA Change: S1139G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216574
Predicted Effect unknown
Transcript: ENSMUST00000217656
AA Change: S963G
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60872225 missense probably benign
IGL01751:Uaca APN 9 60869857 missense probably damaging 1.00
IGL02868:Uaca APN 9 60863637 missense probably damaging 1.00
IGL02977:Uaca APN 9 60866380 missense probably benign 0.00
IGL03037:Uaca APN 9 60840865 missense probably damaging 1.00
IGL03060:Uaca APN 9 60869866 missense probably damaging 1.00
IGL03083:Uaca APN 9 60863663 missense probably benign 0.28
IGL03266:Uaca APN 9 60863407 missense probably damaging 1.00
IGL03346:Uaca APN 9 60854318 missense probably damaging 1.00
R0408:Uaca UTSW 9 60871859 missense possibly damaging 0.71
R0567:Uaca UTSW 9 60871381 missense probably benign 0.01
R0598:Uaca UTSW 9 60870921 nonsense probably null
R0603:Uaca UTSW 9 60871097 missense possibly damaging 0.60
R0655:Uaca UTSW 9 60872029 missense probably benign 0.03
R0707:Uaca UTSW 9 60848618 splice site probably benign
R0791:Uaca UTSW 9 60872059 missense possibly damaging 0.50
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1520:Uaca UTSW 9 60871381 missense probably benign 0.30
R1673:Uaca UTSW 9 60872156 missense probably damaging 1.00
R1894:Uaca UTSW 9 60870436 missense possibly damaging 0.87
R1997:Uaca UTSW 9 60870341 missense probably damaging 1.00
R2042:Uaca UTSW 9 60869891 missense probably damaging 1.00
R2095:Uaca UTSW 9 60840843 missense probably benign 0.00
R2148:Uaca UTSW 9 60869679 missense probably damaging 1.00
R2384:Uaca UTSW 9 60869917 missense probably damaging 1.00
R3110:Uaca UTSW 9 60871499 missense probably damaging 1.00
R3112:Uaca UTSW 9 60871499 missense probably damaging 1.00
R4001:Uaca UTSW 9 60871084 missense probably benign 0.04
R4156:Uaca UTSW 9 60871753 missense probably benign 0.02
R4157:Uaca UTSW 9 60871753 missense probably benign 0.02
R4410:Uaca UTSW 9 60869891 missense probably damaging 1.00
R4674:Uaca UTSW 9 60854429 missense possibly damaging 0.94
R4871:Uaca UTSW 9 60846001 missense probably damaging 1.00
R5130:Uaca UTSW 9 60880228 missense probably damaging 0.96
R5328:Uaca UTSW 9 60870532 missense probably benign 0.44
R5358:Uaca UTSW 9 60871148 missense probably benign
R5415:Uaca UTSW 9 60870139 missense possibly damaging 0.65
R5437:Uaca UTSW 9 60871451 missense probably benign
R5647:Uaca UTSW 9 60872098 missense probably benign 0.28
R5710:Uaca UTSW 9 60871811 missense probably damaging 1.00
R5920:Uaca UTSW 9 60869603 missense probably benign 0.19
R5931:Uaca UTSW 9 60872012 missense probably damaging 0.97
R5933:Uaca UTSW 9 60840956 missense probably damaging 1.00
R5959:Uaca UTSW 9 60870770 missense probably damaging 1.00
R6193:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6195:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6242:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6243:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6244:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6274:Uaca UTSW 9 60850291 splice site probably null
R6670:Uaca UTSW 9 60872024 missense probably benign 0.09
R6883:Uaca UTSW 9 60869891 missense probably damaging 1.00
R7011:Uaca UTSW 9 60870368 missense probably damaging 1.00
R7111:Uaca UTSW 9 60871838 missense probably benign 0.06
R7146:Uaca UTSW 9 60870413 missense probably damaging 0.99
X0067:Uaca UTSW 9 60859149 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGACCTGTCCCAAAAGTACAGC -3'
(R):5'- CCGTCTGGAGTTTGGAGACTTC -3'

Sequencing Primer
(F):5'- GTCCCAAAAGTACAGCGACGTG -3'
(R):5'- GAGACTTCCTTGGTTTTCTTCTGGC -3'
Posted On2015-05-14