Mutagenetix > Incidental Mutation

Incidental Mutation 'R4117:Adamts16'

315145

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 16

Synonyms

MMRRC Submission

040991-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4117 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70875921-70989930 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70916111 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 775 (Y775H)

Ref Sequence

ENSEMBL: ENSMUSP00000105316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably benign
Transcript: ENSMUST00000080145
AA Change: Y775H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: Y775H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109694
AA Change: Y775H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: Y775H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	2.2e-32	PFAM
Pfam:Reprolysin_5	287	470	1.8e-13	PFAM
Pfam:Reprolysin_4	289	489	7.3e-9	PFAM
Pfam:Reprolysin	289	493	4.6e-33	PFAM
Pfam:Reprolysin_2	306	483	4.1e-10	PFAM
Pfam:Reprolysin_3	310	442	3.3e-10	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Meta Mutation Damage Score

0.1042

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

97% (31/32)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	T	C	2: 155,398,313 (GRCm39)	F358L	probably damaging	Het
Bard1	A	T	1: 71,085,922 (GRCm39)	H594Q	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,619,782 (GRCm39)		probably benign	Het
Cenpt	G	A	8: 106,576,332 (GRCm39)	S73L	probably benign	Het
Ctdnep1	C	A	11: 69,879,497 (GRCm39)	A7D	probably damaging	Het
Fam210b	T	C	2: 172,193,486 (GRCm39)	S100P	probably benign	Het
Fyb1	A	C	15: 6,659,597 (GRCm39)	D434A	probably damaging	Het
H2-T15	T	C	17: 36,368,496 (GRCm39)	D144G	probably damaging	Het
Heph	T	C	X: 95,544,221 (GRCm39)	V615A	probably benign	Het
Icam5	T	A	9: 20,948,886 (GRCm39)	V746E	probably damaging	Het
Maml2	A	G	9: 13,617,230 (GRCm39)	Q192R	probably damaging	Het
Npas4	T	C	19: 5,037,391 (GRCm39)	Y301C	probably damaging	Het
Nup205	C	T	6: 35,217,947 (GRCm39)	Q1767*	probably null	Het
Or51f5	T	A	7: 102,423,684 (GRCm39)		probably null	Het
Pigg	A	G	5: 108,495,908 (GRCm39)	R982G	probably benign	Het
Plekhg2	A	T	7: 28,060,313 (GRCm39)	H1005Q	probably benign	Het
Rdh12	C	T	12: 79,260,419 (GRCm39)	R172C	probably damaging	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Semp2l2b	T	A	10: 21,943,615 (GRCm39)	N122Y	probably benign	Het
Septin4	T	C	11: 87,459,108 (GRCm39)	F494S	probably damaging	Het
Serpinb9	T	A	13: 33,199,579 (GRCm39)	D291E	probably benign	Het
She	A	T	3: 89,759,679 (GRCm39)	Y394F	probably damaging	Het
Sipa1l2	T	C	8: 126,195,249 (GRCm39)	S830G	probably damaging	Het
Stmn4	T	C	14: 66,598,581 (GRCm39)	*217Q	probably null	Het
Stx17	A	G	4: 48,180,689 (GRCm39)	D178G	probably damaging	Het
Tbc1d9	T	G	8: 83,992,776 (GRCm39)	I960S	possibly damaging	Het
Ubxn10	G	T	4: 138,448,276 (GRCm39)	D133E	probably benign	Het
Vmn2r42	T	C	7: 8,197,839 (GRCm39)	Y260C	probably damaging	Het
Vmn2r7	A	C	3: 64,623,138 (GRCm39)		probably benign	Het
Zfp143	C	T	7: 109,691,120 (GRCm39)	T557I	probably damaging	Het
Zfp607b	A	G	7: 27,398,107 (GRCm39)	I64V	probably damaging	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70,943,603 (GRCm39)	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70,984,234 (GRCm39)	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70,941,260 (GRCm39)	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70,949,080 (GRCm39)	nonsense	probably null
IGL01874:Adamts16	APN	13	70,916,823 (GRCm39)	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70,935,266 (GRCm39)	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70,921,048 (GRCm39)	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70,935,289 (GRCm39)	splice site	probably benign
IGL02450:Adamts16	APN	13	70,984,419 (GRCm39)	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70,886,897 (GRCm39)	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70,901,410 (GRCm39)	missense	probably benign	0.00
swap	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
switcheroo	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70,927,763 (GRCm39)	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70,927,730 (GRCm39)	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70,927,671 (GRCm39)	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70,887,074 (GRCm39)	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70,916,766 (GRCm39)	missense	probably benign
R0524:Adamts16	UTSW	13	70,949,013 (GRCm39)	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0734:Adamts16	UTSW	13	70,886,600 (GRCm39)	splice site	probably benign
R0787:Adamts16	UTSW	13	70,886,948 (GRCm39)	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70,916,811 (GRCm39)	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70,911,680 (GRCm39)	splice site	probably benign
R1027:Adamts16	UTSW	13	70,915,921 (GRCm39)	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70,946,154 (GRCm39)	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70,927,717 (GRCm39)	splice site	probably null
R1869:Adamts16	UTSW	13	70,883,866 (GRCm39)	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70,940,005 (GRCm39)	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70,901,386 (GRCm39)	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70,949,126 (GRCm39)	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70,887,010 (GRCm39)	missense	possibly damaging	0.92
R4435:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70,927,743 (GRCm39)	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70,901,315 (GRCm39)	nonsense	probably null
R5464:Adamts16	UTSW	13	70,909,868 (GRCm39)	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70,878,253 (GRCm39)	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70,984,494 (GRCm39)	nonsense	probably null
R5735:Adamts16	UTSW	13	70,984,337 (GRCm39)	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70,886,617 (GRCm39)	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70,877,029 (GRCm39)	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70,918,393 (GRCm39)	nonsense	probably null
R6351:Adamts16	UTSW	13	70,984,322 (GRCm39)	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70,927,689 (GRCm39)	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70,877,017 (GRCm39)	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70,916,639 (GRCm39)	splice site	probably null
R6996:Adamts16	UTSW	13	70,946,157 (GRCm39)	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70,921,074 (GRCm39)	nonsense	probably null
R7356:Adamts16	UTSW	13	70,984,399 (GRCm39)	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70,935,283 (GRCm39)	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70,878,234 (GRCm39)	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70,984,265 (GRCm39)	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70,886,701 (GRCm39)	missense	probably benign
R8231:Adamts16	UTSW	13	70,925,599 (GRCm39)	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70,941,217 (GRCm39)	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70,984,496 (GRCm39)	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70,886,794 (GRCm39)	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70,984,453 (GRCm39)	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70,941,307 (GRCm39)	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70,939,910 (GRCm39)	splice site	probably benign
R8973:Adamts16	UTSW	13	70,886,959 (GRCm39)	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70,883,948 (GRCm39)	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70,949,045 (GRCm39)	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70,949,136 (GRCm39)	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70,909,892 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCTGGTCTCTACCTCCAC -3'
(R):5'- ATTACGCCTCCAACCAATGATG -3'

Sequencing Primer
(F):5'- CCACAATCAGAGTTTCATTGGTTGG -3'
(R):5'- GCCTCCAACCAATGATGAAAAGGG -3'

Posted On

2015-05-14