Incidental Mutation 'R4118:Tiam1'
ID315195
Institutional Source Beutler Lab
Gene Symbol Tiam1
Ensembl Gene ENSMUSG00000002489
Gene NameT cell lymphoma invasion and metastasis 1
SynonymsD16Ium10e, D16Ium10
MMRRC Submission 041631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4118 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location89787111-90143769 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 89877033 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002588] [ENSMUST00000114124] [ENSMUST00000163370]
Predicted Effect probably null
Transcript: ENSMUST00000002588
SMART Domains Protein: ENSMUSP00000002588
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114124
SMART Domains Protein: ENSMUSP00000109759
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163370
SMART Domains Protein: ENSMUSP00000132137
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 92% (55/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele display resistance to chemically-induced tumors, however, tumors that do develop progress to malignancy. Mice homozygous for a gene trap allele display anencephaly, exencephaly and/or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,854 R31G possibly damaging Het
4932414N04Rik C T 2: 68,736,513 R419C probably benign Het
Ankmy1 T C 1: 92,888,696 E232G possibly damaging Het
Arhgef4 A T 1: 34,732,347 K1245M probably damaging Het
Atp2c1 A G 9: 105,466,659 L83P probably damaging Het
Atp9b T C 18: 80,749,829 D1000G possibly damaging Het
Atxn7 T C 14: 14,100,308 S665P probably benign Het
Bbs4 T C 9: 59,330,425 Y212C possibly damaging Het
Cars A G 7: 143,559,647 probably null Het
Cep162 T C 9: 87,204,176 T1032A probably benign Het
Chd7 G A 4: 8,865,831 E668K probably damaging Het
Dek T C 13: 47,088,600 T201A probably benign Het
Depdc5 T A 5: 32,964,635 S1079T probably damaging Het
Etaa1 A T 11: 17,946,180 S646T probably benign Het
Fat1 T C 8: 45,010,437 S1339P probably damaging Het
Fat1 C A 8: 45,050,944 D4491E probably damaging Het
Gmps T C 3: 63,980,194 V29A probably benign Het
Gpr18 T C 14: 121,912,556 E19G probably benign Het
Ipo5 A G 14: 120,938,661 T633A probably benign Het
Jmjd1c T A 10: 67,219,753 S317R probably damaging Het
Lama3 T A 18: 12,450,431 M692K probably benign Het
Lrp12 A T 15: 39,877,965 C451* probably null Het
Lrp2 C T 2: 69,430,262 probably null Het
Myrfl T A 10: 116,828,965 I387F probably damaging Het
Naglu G A 11: 101,074,082 V332I probably benign Het
Nat2 G A 8: 67,501,619 R127H possibly damaging Het
Otx2 G A 14: 48,659,154 T141I probably benign Het
Paqr9 T A 9: 95,560,899 I314N probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Ppm1d A G 11: 85,311,582 D37G probably benign Het
Prdm9 T G 17: 15,544,013 D835A probably benign Het
Ptprq A G 10: 107,711,920 S206P probably benign Het
Rapgef2 A G 3: 79,068,887 probably null Het
Rpgrip1l G A 8: 91,252,907 T969I probably benign Het
Rpp40 A G 13: 35,896,804 Y316H probably damaging Het
Serpinb3d A T 1: 107,079,230 D249E possibly damaging Het
Slc22a29 A C 19: 8,160,529 probably benign Het
Slc35f1 T C 10: 53,089,368 M293T probably damaging Het
Slmap A T 14: 26,482,872 L98H probably damaging Het
Tlr11 A G 14: 50,363,227 Y890C probably damaging Het
Tmem131l T C 3: 83,960,767 T194A probably benign Het
Ubap1 A T 4: 41,371,767 D26V probably damaging Het
Vmn2r91 T A 17: 18,110,096 N547K probably damaging Het
Wiz C T 17: 32,369,357 probably benign Het
Wwp2 A G 8: 107,545,459 T399A probably benign Het
Zfp729b A T 13: 67,592,710 F479I possibly damaging Het
Zswim5 G A 4: 116,986,819 R1018H possibly damaging Het
Other mutations in Tiam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tiam1 APN 16 89794739 missense probably damaging 1.00
IGL01356:Tiam1 APN 16 89837788 missense probably damaging 0.99
IGL01583:Tiam1 APN 16 89789280 missense probably damaging 1.00
IGL01626:Tiam1 APN 16 89812968 missense probably damaging 1.00
IGL01802:Tiam1 APN 16 89898372 missense possibly damaging 0.94
IGL01818:Tiam1 APN 16 89867704 missense probably damaging 1.00
IGL02146:Tiam1 APN 16 89849681 missense probably benign 0.20
IGL02329:Tiam1 APN 16 89800036 missense probably benign 0.08
IGL02341:Tiam1 APN 16 89898369 missense probably damaging 1.00
IGL02622:Tiam1 APN 16 89798700 missense possibly damaging 0.59
F5770:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
PIT4515001:Tiam1 UTSW 16 89860242 missense probably damaging 0.99
R0130:Tiam1 UTSW 16 89897754 missense probably benign 0.01
R0143:Tiam1 UTSW 16 89898200 missense probably benign 0.01
R0158:Tiam1 UTSW 16 89793001 critical splice donor site probably benign
R0413:Tiam1 UTSW 16 89809365 splice site probably benign
R0449:Tiam1 UTSW 16 89837827 missense possibly damaging 0.75
R0520:Tiam1 UTSW 16 89817951 splice site probably benign
R0667:Tiam1 UTSW 16 89897984 missense probably damaging 1.00
R0787:Tiam1 UTSW 16 89789561 missense probably damaging 1.00
R1355:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1370:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1534:Tiam1 UTSW 16 89867508 critical splice donor site probably null
R1769:Tiam1 UTSW 16 89860279 missense probably damaging 1.00
R1831:Tiam1 UTSW 16 89860294 missense probably benign 0.01
R1913:Tiam1 UTSW 16 89798694 missense probably damaging 1.00
R2022:Tiam1 UTSW 16 89877187 missense probably benign
R2140:Tiam1 UTSW 16 89849645 splice site probably benign
R2383:Tiam1 UTSW 16 89798684 missense probably benign 0.29
R2697:Tiam1 UTSW 16 89793164 missense probably benign 0.00
R4327:Tiam1 UTSW 16 89855891 missense possibly damaging 0.80
R4693:Tiam1 UTSW 16 89843282 missense possibly damaging 0.87
R5104:Tiam1 UTSW 16 89818041 missense probably benign 0.00
R5412:Tiam1 UTSW 16 89884865 missense possibly damaging 0.52
R5426:Tiam1 UTSW 16 89865392 missense possibly damaging 0.58
R5600:Tiam1 UTSW 16 89865365 missense probably damaging 1.00
R5842:Tiam1 UTSW 16 89855999 missense probably benign
R5986:Tiam1 UTSW 16 89789186 missense probably benign 0.31
R6077:Tiam1 UTSW 16 89798030 critical splice donor site probably null
R6419:Tiam1 UTSW 16 89898024 nonsense probably null
R6525:Tiam1 UTSW 16 89858597 critical splice donor site probably null
R6950:Tiam1 UTSW 16 89860204 critical splice donor site probably null
R7127:Tiam1 UTSW 16 89860260 missense probably damaging 1.00
R7197:Tiam1 UTSW 16 89884938 missense probably damaging 1.00
R7249:Tiam1 UTSW 16 89843255 missense probably damaging 1.00
V7582:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCACAACTTTCCTCGGGC -3'
(R):5'- GTGCACGAAATAATCACTCGG -3'

Sequencing Primer
(F):5'- GGGCCTCACATGCACACTC -3'
(R):5'- ATAATCACTCGGACCCCATTCTG -3'
Posted On2015-05-14