Incidental Mutation 'R4119:Fbxo7'
ID315235
Institutional Source Beutler Lab
Gene Symbol Fbxo7
Ensembl Gene ENSMUSG00000001786
Gene NameF-box protein 7
Synonyms2410015K21Rik, A230052G17Rik
MMRRC Submission 040992-MU
Accession Numbers

NCBI RefSeq: NM_153195.2; MGI: 1917004

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4119 (G1)
Quality Score210
Status Validated
Chromosome10
Chromosomal Location86021972-86051873 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 86021895 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001837] [ENSMUST00000117597] [ENSMUST00000120344] [ENSMUST00000130320] [ENSMUST00000147168]
Predicted Effect probably benign
Transcript: ENSMUST00000001837
SMART Domains Protein: ENSMUSP00000001837
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
Blast:UBQ 1 40 7e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117597
SMART Domains Protein: ENSMUSP00000113263
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 101 245 9.6e-31 PFAM
Pfam:F-box 250 297 2.7e-6 PFAM
Pfam:F-box-like 252 298 7.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120344
SMART Domains Protein: ENSMUSP00000113222
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 103 247 4.8e-31 PFAM
Pfam:F-box 252 299 1.8e-6 PFAM
Pfam:F-box-like 254 300 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130320
SMART Domains Protein: ENSMUSP00000120840
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 78 7e-6 SMART
Blast:UBQ 1 79 6e-30 BLAST
Pfam:PI31_Prot_N 188 323 4.7e-20 PFAM
Pfam:F-box 331 378 9.7e-6 PFAM
Pfam:F-box-like 333 379 9.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181665
SMART Domains Protein: ENSMUSP00000137845
Gene: ENSMUSG00000097692

DomainStartEndE-ValueType
low complexity region 77 90 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190739
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype Strain: 4434927
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased pro-B cell numbers and increased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(4) Gene trapped(3)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Fbxo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Fbxo7 APN 10 86029064 missense probably damaging 0.98
IGL01483:Fbxo7 APN 10 86044581 missense probably damaging 1.00
IGL02502:Fbxo7 APN 10 86033297 missense probably damaging 1.00
IGL02712:Fbxo7 APN 10 86024438 missense possibly damaging 0.75
P0007:Fbxo7 UTSW 10 86033293 missense possibly damaging 0.95
R0410:Fbxo7 UTSW 10 86029238 critical splice donor site probably null
R4604:Fbxo7 UTSW 10 86046802 missense probably damaging 1.00
R4884:Fbxo7 UTSW 10 86029150 missense probably damaging 0.99
R5088:Fbxo7 UTSW 10 86021920 unclassified probably benign
R5286:Fbxo7 UTSW 10 86022090 missense probably damaging 1.00
R5387:Fbxo7 UTSW 10 86024654 missense probably benign 0.01
R5451:Fbxo7 UTSW 10 86029037 missense probably benign 0.01
R5491:Fbxo7 UTSW 10 86048026 missense probably damaging 1.00
R5542:Fbxo7 UTSW 10 86033285 missense probably benign 0.00
R5647:Fbxo7 UTSW 10 86029110 missense probably damaging 0.98
R6027:Fbxo7 UTSW 10 86048086 missense probably damaging 1.00
R6152:Fbxo7 UTSW 10 86024696 missense probably benign 0.01
R6280:Fbxo7 UTSW 10 86029105 missense probably benign 0.00
R6615:Fbxo7 UTSW 10 86044534 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AAGATCCTGCTTGCTGGGAG -3'
(R):5'- GAAACCCCGGAAGTGACTAC -3'

Sequencing Primer
(F):5'- GGGAAGGAACAAACTCGCTCAC -3'
(R):5'- AGCGTCACAGTCACAGGC -3'
Posted On2015-05-14