Incidental Mutation 'R4119:Msh3'
ID315241
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationintron (669 bp from exon)
DNA Base Change (assembly) A to G at 92354011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022218] [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187424] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably benign
Transcript: ENSMUST00000022218
SMART Domains Protein: ENSMUSP00000022218
Gene: ENSMUSG00000021707

DomainStartEndE-ValueType
Pfam:DHFR_1 4 185 3.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022220
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185852
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186878
Predicted Effect probably benign
Transcript: ENSMUST00000187424
SMART Domains Protein: ENSMUSP00000139622
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187831
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190393
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 Y234H probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 E654G probably benign Het
Ezh2 A C 6: 47,544,548 N429K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V548A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 I845N probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1316L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.87
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 unclassified probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGTGGTGAGTGCAAAATGAATC -3'
(R):5'- CCAGTGTAAGCATTTAGATGGATG -3'

Sequencing Primer
(F):5'- TGGTGAGTGCAAAATGAATCTTAGTG -3'
(R):5'- AGATGGATGAAGTTTCTGTACATGC -3'
Posted OnMay 14, 2015