Incidental Mutation 'R4120:Adgrb3'
ID315250
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission 040993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R4120 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 25094307 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1233 (E1233*)
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably null
Transcript: ENSMUST00000041838
AA Change: E1233*
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: E1233*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126096
Predicted Effect probably null
Transcript: ENSMUST00000126626
AA Change: E363*
SMART Domains Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: E363*

DomainStartEndE-ValueType
Pfam:7tm_2 4 273 7.3e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135518
AA Change: E1233*
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: E1233*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146592
AA Change: E993*
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: E993*

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151309
AA Change: E1233*
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: E1233*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153568
Meta Mutation Damage Score 0.522 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,739,172 D526G probably damaging Het
Ago4 A G 4: 126,496,807 Y807H probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap40 A G 2: 158,532,330 M222V probably benign Het
Asnsd1 A G 1: 53,347,995 S158P probably damaging Het
C130026I21Rik C T 1: 85,259,821 V81M possibly damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Col4a1 G A 8: 11,206,263 P1535S unknown Het
Dennd2a G A 6: 39,465,096 R947C probably damaging Het
Dlg2 G A 7: 91,965,638 V217I probably damaging Het
Dnaaf2 T C 12: 69,198,038 D83G possibly damaging Het
Dppa5a A T 9: 78,367,855 M55K possibly damaging Het
Ect2l A G 10: 18,130,718 V779A probably benign Het
Ehhadh A G 16: 21,763,184 S353P probably benign Het
Etv3 A G 3: 87,536,282 D391G probably benign Het
Fastkd1 T A 2: 69,707,310 K309N probably damaging Het
Fip1l1 T A 5: 74,588,191 Y375N probably damaging Het
Flvcr2 T C 12: 85,786,129 S308P probably benign Het
Fyco1 T C 9: 123,825,626 Y1065C probably benign Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Gm17175 A T 14: 51,573,077 I31N probably damaging Het
Gm6003 T A 7: 33,165,551 noncoding transcript Het
Gm9951 T C 8: 34,055,839 noncoding transcript Het
Hspa2 A G 12: 76,405,234 E234G probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Iqsec1 A T 6: 90,662,602 Y1065* probably null Het
Ltk T A 2: 119,757,948 probably benign Het
Map2 G A 1: 66,415,904 A1318T probably damaging Het
Mas1 A T 17: 12,842,346 N63K probably damaging Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nav3 A G 10: 109,903,744 probably null Het
Nlrp1c-ps T C 11: 71,242,533 noncoding transcript Het
Oca2 A T 7: 56,254,882 D32V probably damaging Het
Olfr624 T C 7: 103,671,014 T6A probably benign Het
Olfr877 T C 9: 37,855,409 L197S possibly damaging Het
Otub2 T C 12: 103,404,230 V257A probably damaging Het
Pink1 G A 4: 138,315,511 R461* probably null Het
Plxna2 T C 1: 194,780,627 C901R probably damaging Het
Ptchd3 T A 11: 121,830,746 N148K probably damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Ripor1 T A 8: 105,618,857 probably benign Het
Sec13 T C 6: 113,734,676 N107S probably damaging Het
Slc12a2 A G 18: 57,899,355 M376V possibly damaging Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Stradb T A 1: 58,980,009 Y30N possibly damaging Het
Syne1 T A 10: 5,409,798 Q328L probably damaging Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Vmn2r100 T C 17: 19,531,953 S753P probably damaging Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Vmn2r-ps159 G T 4: 156,334,483 noncoding transcript Het
Zfp936 A G 7: 43,190,206 T366A probably benign Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGATTGTCATCCGTGCATAAG -3'
(R):5'- CAATTCAGTAATCTGGACCATGAAC -3'

Sequencing Primer
(F):5'- GTGCATAAGTACACAGTTCTCCG -3'
(R):5'- GTAATCTGGACCATGAACAAAAACAG -3'
Posted On2015-05-14