Incidental Mutation 'R4120:Cdh15'
ID 315278
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Name cadherin 15
Synonyms M cadherin, Mcad, Cdh14
MMRRC Submission 040993-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4120 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123575113-123594136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123590162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 365 (V365A)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
AlphaFold P33146
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: V365A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: V365A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.7434 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 C A 1: 25,133,388 (GRCm39) E1233* probably null Het
Afap1l1 T C 18: 61,872,243 (GRCm39) D526G probably damaging Het
Ago4 A G 4: 126,390,600 (GRCm39) Y807H probably damaging Het
Ankfy1 G A 11: 72,605,310 (GRCm39) probably null Het
Arhgap40 A G 2: 158,374,250 (GRCm39) M222V probably benign Het
Asnsd1 A G 1: 53,387,154 (GRCm39) S158P probably damaging Het
Clca3a2 T C 3: 144,516,613 (GRCm39) M328V probably benign Het
Col4a1 G A 8: 11,256,263 (GRCm39) P1535S unknown Het
Dennd2a G A 6: 39,442,030 (GRCm39) R947C probably damaging Het
Dlg2 G A 7: 91,614,846 (GRCm39) V217I probably damaging Het
Dnaaf2 T C 12: 69,244,812 (GRCm39) D83G possibly damaging Het
Dppa5a A T 9: 78,275,137 (GRCm39) M55K possibly damaging Het
Ect2l A G 10: 18,006,466 (GRCm39) V779A probably benign Het
Ehhadh A G 16: 21,581,934 (GRCm39) S353P probably benign Het
Etv3 A G 3: 87,443,589 (GRCm39) D391G probably benign Het
Fastkd1 T A 2: 69,537,654 (GRCm39) K309N probably damaging Het
Fip1l1 T A 5: 74,748,852 (GRCm39) Y375N probably damaging Het
Flvcr2 T C 12: 85,832,903 (GRCm39) S308P probably benign Het
Fyco1 T C 9: 123,654,691 (GRCm39) Y1065C probably benign Het
Gfra2 A G 14: 71,203,715 (GRCm39) D31G probably damaging Het
Gm17175 A T 14: 51,810,534 (GRCm39) I31N probably damaging Het
Gm6003 T A 7: 32,864,976 (GRCm39) noncoding transcript Het
Gm9951 T C 8: 34,522,993 (GRCm39) noncoding transcript Het
Hspa2 A G 12: 76,452,008 (GRCm39) E234G probably damaging Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Iqsec1 A T 6: 90,639,584 (GRCm39) Y1065* probably null Het
Ltk T A 2: 119,588,429 (GRCm39) probably benign Het
Map2 G A 1: 66,455,063 (GRCm39) A1318T probably damaging Het
Mas1 A T 17: 13,061,233 (GRCm39) N63K probably damaging Het
Myo15b T C 11: 115,764,318 (GRCm39) S1311P probably benign Het
Nav3 A G 10: 109,739,605 (GRCm39) probably null Het
Nlrp1c-ps T C 11: 71,133,359 (GRCm39) noncoding transcript Het
Oca2 A T 7: 55,904,630 (GRCm39) D32V probably damaging Het
Or51v8 T C 7: 103,320,221 (GRCm39) T6A probably benign Het
Or8b9 T C 9: 37,766,705 (GRCm39) L197S possibly damaging Het
Otub2 T C 12: 103,370,489 (GRCm39) V257A probably damaging Het
Pink1 G A 4: 138,042,822 (GRCm39) R461* probably null Het
Plxna2 T C 1: 194,462,935 (GRCm39) C901R probably damaging Het
Ptchd3 T A 11: 121,721,572 (GRCm39) N148K probably damaging Het
Ralgapa1 C T 12: 55,687,429 (GRCm39) R2019Q probably damaging Het
Ripor1 T A 8: 106,345,489 (GRCm39) probably benign Het
Sec13 T C 6: 113,711,637 (GRCm39) N107S probably damaging Het
Slc12a2 A G 18: 58,032,427 (GRCm39) M376V possibly damaging Het
Sp140l2 C T 1: 85,237,542 (GRCm39) V81M possibly damaging Het
Sptbn5 T A 2: 119,895,010 (GRCm39) D798V possibly damaging Het
Stradb T A 1: 59,019,168 (GRCm39) Y30N possibly damaging Het
Syne1 T A 10: 5,359,798 (GRCm39) Q328L probably damaging Het
Ttc23l A C 15: 10,540,006 (GRCm39) V159G probably damaging Het
Vmn2r100 T C 17: 19,752,215 (GRCm39) S753P probably damaging Het
Vmn2r129 G T 4: 156,686,778 (GRCm39) noncoding transcript Het
Vmn2r39 G A 7: 9,026,673 (GRCm39) H443Y probably benign Het
Zfp936 A G 7: 42,839,630 (GRCm39) T366A probably benign Het
Zkscan3 T C 13: 21,578,119 (GRCm39) E256G possibly damaging Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 123,592,062 (GRCm39) intron probably benign
IGL01958:Cdh15 APN 8 123,586,089 (GRCm39) missense probably damaging 1.00
IGL02588:Cdh15 APN 8 123,583,291 (GRCm39) nonsense probably null
IGL02793:Cdh15 APN 8 123,587,721 (GRCm39) missense probably damaging 1.00
IGL02947:Cdh15 APN 8 123,592,111 (GRCm39) missense probably benign 0.00
R0310:Cdh15 UTSW 8 123,592,175 (GRCm39) missense probably damaging 1.00
R0441:Cdh15 UTSW 8 123,587,705 (GRCm39) missense probably damaging 1.00
R0766:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R0898:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1023:Cdh15 UTSW 8 123,591,939 (GRCm39) missense probably damaging 0.98
R1054:Cdh15 UTSW 8 123,591,076 (GRCm39) missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R1081:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1101:Cdh15 UTSW 8 123,587,585 (GRCm39) missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1209:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1210:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1312:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R1317:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1318:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1393:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1428:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1429:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1695:Cdh15 UTSW 8 123,588,755 (GRCm39) missense probably benign 0.05
R2157:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2170:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2178:Cdh15 UTSW 8 123,591,715 (GRCm39) splice site probably null
R2252:Cdh15 UTSW 8 123,584,161 (GRCm39) missense probably damaging 1.00
R2290:Cdh15 UTSW 8 123,586,056 (GRCm39) missense probably damaging 1.00
R2317:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2330:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2345:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2349:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2353:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2354:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2566:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2567:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2568:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2893:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2894:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2937:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2938:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2990:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2992:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2993:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3029:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3030:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3195:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R3441:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3442:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3608:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3686:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4119:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4477:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4478:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4480:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4580:Cdh15 UTSW 8 123,591,897 (GRCm39) missense probably damaging 0.99
R4583:Cdh15 UTSW 8 123,591,767 (GRCm39) missense probably damaging 0.98
R4619:Cdh15 UTSW 8 123,587,612 (GRCm39) missense probably damaging 1.00
R4694:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4731:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R5076:Cdh15 UTSW 8 123,591,087 (GRCm39) missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 123,588,802 (GRCm39) missense probably null 1.00
R5375:Cdh15 UTSW 8 123,591,839 (GRCm39) missense probably damaging 1.00
R5498:Cdh15 UTSW 8 123,591,917 (GRCm39) missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 123,583,326 (GRCm39) missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 123,591,086 (GRCm39) missense probably benign 0.01
R6570:Cdh15 UTSW 8 123,584,130 (GRCm39) missense probably damaging 1.00
R6708:Cdh15 UTSW 8 123,590,294 (GRCm39) missense probably benign 0.32
R7505:Cdh15 UTSW 8 123,575,231 (GRCm39) missense probably benign 0.01
R7527:Cdh15 UTSW 8 123,588,865 (GRCm39) missense probably damaging 1.00
R7724:Cdh15 UTSW 8 123,593,700 (GRCm39) missense probably damaging 1.00
R8093:Cdh15 UTSW 8 123,593,574 (GRCm39) missense probably damaging 1.00
R8485:Cdh15 UTSW 8 123,584,105 (GRCm39) missense probably damaging 1.00
R8759:Cdh15 UTSW 8 123,587,628 (GRCm39) missense probably damaging 1.00
R8910:Cdh15 UTSW 8 123,575,240 (GRCm39) missense probably benign 0.04
R9017:Cdh15 UTSW 8 123,584,256 (GRCm39) critical splice donor site probably null
R9453:Cdh15 UTSW 8 123,586,029 (GRCm39) missense probably damaging 0.99
R9699:Cdh15 UTSW 8 123,588,769 (GRCm39) missense probably benign 0.00
R9705:Cdh15 UTSW 8 123,591,024 (GRCm39) missense probably damaging 1.00
Z1176:Cdh15 UTSW 8 123,590,998 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCTCTTAACACCTGGC -3'
(R):5'- GGATGTACACCAATGGCCTTTC -3'

Sequencing Primer
(F):5'- AACACCTGGCATTTCAGCTG -3'
(R):5'- TGCACCCTCAGATTCTAGAGG -3'
Posted On 2015-05-14