Incidental Mutation 'R4120:Afap1l1'
ID315303
Institutional Source Beutler Lab
Gene Symbol Afap1l1
Ensembl Gene ENSMUSG00000033032
Gene Nameactin filament associated protein 1-like 1
Synonyms
MMRRC Submission 040993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R4120 (G1)
Quality Score206
Status Validated
Chromosome18
Chromosomal Location61730261-61786702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61739172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 526 (D526G)
Ref Sequence ENSEMBL: ENSMUSP00000113286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120472] [ENSMUST00000154876]
Predicted Effect probably damaging
Transcript: ENSMUST00000120472
AA Change: D526G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113286
Gene: ENSMUSG00000033032
AA Change: D526G

DomainStartEndE-ValueType
low complexity region 114 123 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
PH 221 318 4.13e-6 SMART
PH 419 514 9.41e-10 SMART
coiled coil region 611 701 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147278
Predicted Effect probably benign
Transcript: ENSMUST00000154876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184678
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (55/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 C A 1: 25,094,307 E1233* probably null Het
Ago4 A G 4: 126,496,807 Y807H probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap40 A G 2: 158,532,330 M222V probably benign Het
Asnsd1 A G 1: 53,347,995 S158P probably damaging Het
C130026I21Rik C T 1: 85,259,821 V81M possibly damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Col4a1 G A 8: 11,206,263 P1535S unknown Het
Dennd2a G A 6: 39,465,096 R947C probably damaging Het
Dlg2 G A 7: 91,965,638 V217I probably damaging Het
Dnaaf2 T C 12: 69,198,038 D83G possibly damaging Het
Dppa5a A T 9: 78,367,855 M55K possibly damaging Het
Ect2l A G 10: 18,130,718 V779A probably benign Het
Ehhadh A G 16: 21,763,184 S353P probably benign Het
Etv3 A G 3: 87,536,282 D391G probably benign Het
Fastkd1 T A 2: 69,707,310 K309N probably damaging Het
Fip1l1 T A 5: 74,588,191 Y375N probably damaging Het
Flvcr2 T C 12: 85,786,129 S308P probably benign Het
Fyco1 T C 9: 123,825,626 Y1065C probably benign Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Gm17175 A T 14: 51,573,077 I31N probably damaging Het
Gm6003 T A 7: 33,165,551 noncoding transcript Het
Gm9951 T C 8: 34,055,839 noncoding transcript Het
Hspa2 A G 12: 76,405,234 E234G probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Iqsec1 A T 6: 90,662,602 Y1065* probably null Het
Ltk T A 2: 119,757,948 probably benign Het
Map2 G A 1: 66,415,904 A1318T probably damaging Het
Mas1 A T 17: 12,842,346 N63K probably damaging Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nav3 A G 10: 109,903,744 probably null Het
Nlrp1c-ps T C 11: 71,242,533 noncoding transcript Het
Oca2 A T 7: 56,254,882 D32V probably damaging Het
Olfr624 T C 7: 103,671,014 T6A probably benign Het
Olfr877 T C 9: 37,855,409 L197S possibly damaging Het
Otub2 T C 12: 103,404,230 V257A probably damaging Het
Pink1 G A 4: 138,315,511 R461* probably null Het
Plxna2 T C 1: 194,780,627 C901R probably damaging Het
Ptchd3 T A 11: 121,830,746 N148K probably damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Ripor1 T A 8: 105,618,857 probably benign Het
Sec13 T C 6: 113,734,676 N107S probably damaging Het
Slc12a2 A G 18: 57,899,355 M376V possibly damaging Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Stradb T A 1: 58,980,009 Y30N possibly damaging Het
Syne1 T A 10: 5,409,798 Q328L probably damaging Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Vmn2r100 T C 17: 19,531,953 S753P probably damaging Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Vmn2r-ps159 G T 4: 156,334,483 noncoding transcript Het
Zfp936 A G 7: 43,190,206 T366A probably benign Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Afap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Afap1l1 APN 18 61736854 missense probably benign 0.04
IGL01643:Afap1l1 APN 18 61751826 missense probably damaging 1.00
IGL01754:Afap1l1 APN 18 61737494 critical splice donor site probably null
IGL01945:Afap1l1 APN 18 61756863 missense probably benign 0.00
IGL02025:Afap1l1 APN 18 61733699 splice site probably benign
IGL02413:Afap1l1 APN 18 61733789 missense probably benign 0.00
IGL02418:Afap1l1 APN 18 61752577 missense probably damaging 1.00
IGL02493:Afap1l1 APN 18 61737523 missense possibly damaging 0.83
IGL02888:Afap1l1 APN 18 61748808 missense probably damaging 1.00
IGL03010:Afap1l1 APN 18 61743319 missense probably benign 0.01
IGL03122:Afap1l1 APN 18 61733831 missense probably benign
IGL03145:Afap1l1 APN 18 61741809 missense possibly damaging 0.93
IGL03052:Afap1l1 UTSW 18 61748823 missense probably benign 0.00
R0008:Afap1l1 UTSW 18 61756905 missense probably benign 0.11
R0008:Afap1l1 UTSW 18 61756905 missense probably benign 0.11
R0217:Afap1l1 UTSW 18 61746869 missense probably damaging 1.00
R0421:Afap1l1 UTSW 18 61751874 missense probably damaging 1.00
R0626:Afap1l1 UTSW 18 61739220 missense probably benign 0.07
R0963:Afap1l1 UTSW 18 61736930 missense probably damaging 1.00
R1403:Afap1l1 UTSW 18 61741838 missense probably damaging 1.00
R1403:Afap1l1 UTSW 18 61741838 missense probably damaging 1.00
R1566:Afap1l1 UTSW 18 61755643 missense probably benign
R1572:Afap1l1 UTSW 18 61737499 missense probably damaging 1.00
R1854:Afap1l1 UTSW 18 61743294 missense probably benign
R1992:Afap1l1 UTSW 18 61741771 nonsense probably null
R2063:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2064:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2065:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2066:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R4904:Afap1l1 UTSW 18 61738715 missense probably benign 0.00
R4997:Afap1l1 UTSW 18 61751808 missense probably benign
R5379:Afap1l1 UTSW 18 61758650 missense probably damaging 1.00
R5947:Afap1l1 UTSW 18 61743700 missense probably damaging 0.98
R6774:Afap1l1 UTSW 18 61755661 missense probably benign 0.00
R6814:Afap1l1 UTSW 18 61733741 missense probably benign 0.45
R7085:Afap1l1 UTSW 18 61748814 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGCTATGCTTCCCACCTTG -3'
(R):5'- AAACAATTGCGGGTTTCTCTGAC -3'

Sequencing Primer
(F):5'- GTGACATTAACATCCTTCCCAGGG -3'
(R):5'- GTTTCTCTGACACGAGCAAGC -3'
Posted On2015-05-14