Incidental Mutation 'R4124:4930433I11Rik'
ID315317
Institutional Source Beutler Lab
Gene Symbol 4930433I11Rik
Ensembl Gene ENSMUSG00000091692
Gene NameRIKEN cDNA 4930433I11 gene
SynonymsLOC243944
MMRRC Submission 041632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4124 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location40987543-40995435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40993921 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 338 (M338K)
Ref Sequence ENSEMBL: ENSMUSP00000131120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171664] [ENSMUST00000206529]
Predicted Effect probably damaging
Transcript: ENSMUST00000171664
AA Change: M338K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131120
Gene: ENSMUSG00000091692
AA Change: M338K

DomainStartEndE-ValueType
Pfam:DUF4629 208 354 2.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206360
Predicted Effect probably damaging
Transcript: ENSMUST00000206529
AA Change: M429K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik T A 2: 68,616,224 probably benign Het
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Aldh7a1 A T 18: 56,537,323 probably benign Het
Ank T C 15: 27,571,623 F327S probably damaging Het
Ap2b1 A G 11: 83,365,645 probably null Het
Cd6 G T 19: 10,790,608 P630T probably damaging Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
D630003M21Rik C T 2: 158,196,593 V978M probably damaging Het
Dsp A G 13: 38,186,713 D864G probably damaging Het
Duox1 A G 2: 122,337,421 R1062G probably damaging Het
Fbp2 T C 13: 62,854,941 E99G probably damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Gpx6 C T 13: 21,317,645 Q146* probably null Het
Grid2 A T 6: 63,503,433 Q77L probably benign Het
Hrh1 T C 6: 114,480,619 V287A probably benign Het
Kmt2a T C 9: 44,819,796 probably benign Het
Mak A T 13: 41,056,630 D43E probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Poln A G 5: 34,103,951 S561P probably benign Het
Ptpn11 T C 5: 121,137,457 S562G probably benign Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rpgrip1 T C 14: 52,152,324 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slamf9 T C 1: 172,476,241 I51T probably damaging Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tgtp2 T C 11: 49,059,411 I111M probably damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Vmn1r215 A T 13: 23,075,993 T68S probably benign Het
Ypel2 A G 11: 86,945,927 probably null Het
Other mutations in 4930433I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02380:4930433I11Rik APN 7 40994544 missense possibly damaging 0.50
FR4304:4930433I11Rik UTSW 7 40993056 small deletion probably benign
FR4340:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4342:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4548:4930433I11Rik UTSW 7 40993056 small deletion probably benign
R0498:4930433I11Rik UTSW 7 40993294 missense probably benign 0.11
R0610:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0704:4930433I11Rik UTSW 7 40993957 missense probably damaging 1.00
R0723:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0826:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0850:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0862:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0863:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0960:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0961:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0964:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1099:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1101:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1167:4930433I11Rik UTSW 7 40993579 missense probably damaging 1.00
R1401:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1429:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1816:4930433I11Rik UTSW 7 40994798 nonsense probably null
R1852:4930433I11Rik UTSW 7 40993613 missense probably benign 0.29
R3814:4930433I11Rik UTSW 7 40992919 missense probably damaging 0.99
R4823:4930433I11Rik UTSW 7 40993362 missense probably benign 0.00
R5092:4930433I11Rik UTSW 7 40987667 start gained probably benign
R5792:4930433I11Rik UTSW 7 40993521 missense possibly damaging 0.76
R6160:4930433I11Rik UTSW 7 40993526 missense possibly damaging 0.91
R6300:4930433I11Rik UTSW 7 40993461 missense possibly damaging 0.91
R6349:4930433I11Rik UTSW 7 40994772 missense possibly damaging 0.89
R6755:4930433I11Rik UTSW 7 40994310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTCACCCATCATGCCC -3'
(R):5'- CTTGCCTGGAGTTTCGTCAG -3'

Sequencing Primer
(F):5'- ATCATGCCCAGCAGAGCTAGG -3'
(R):5'- AGTTTCGTCAGGGCCCTG -3'
Posted On2015-05-14